Incidental Mutation 'R3003:Vmn2r98'
ID 257379
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Name vomeronasal 2, receptor 98
Synonyms EG224552
MMRRC Submission 040532-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R3003 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 19273755-19301573 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19286125 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 208 (M208V)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
AlphaFold E9PZ56
Predicted Effect probably benign
Transcript: ENSMUST00000170424
AA Change: M208V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: M208V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T C 16: 14,254,393 (GRCm39) V568A probably damaging Het
Acd C T 8: 106,426,913 (GRCm39) probably null Het
Acly T C 11: 100,395,053 (GRCm39) K469E possibly damaging Het
Adh6b G T 3: 138,063,532 (GRCm39) L248F possibly damaging Het
Atg9b G T 5: 24,596,217 (GRCm39) D192E probably damaging Het
Ccdc180 A G 4: 45,899,988 (GRCm39) D182G probably benign Het
Cep112 A G 11: 108,331,329 (GRCm39) E178G probably damaging Het
Clptm1l C T 13: 73,765,875 (GRCm39) T471I possibly damaging Het
Csmd1 A G 8: 16,246,184 (GRCm39) F1072L probably damaging Het
Eprs1 T C 1: 185,156,588 (GRCm39) probably null Het
Il27ra G T 8: 84,758,660 (GRCm39) S499* probably null Het
Klk1b11 T C 7: 43,426,419 (GRCm39) I51T probably damaging Het
Lct T C 1: 128,231,963 (GRCm39) M629V probably damaging Het
Mprip A G 11: 59,618,381 (GRCm39) T91A possibly damaging Het
Pfpl T C 19: 12,407,690 (GRCm39) I647T possibly damaging Het
Plxnc1 A T 10: 94,629,080 (GRCm39) F1565I probably damaging Het
Prr5 G T 15: 84,656,031 (GRCm39) C344F probably damaging Het
Rnf17 T C 14: 56,738,004 (GRCm39) W1262R probably damaging Het
Rptor G A 11: 119,763,197 (GRCm39) R927Q possibly damaging Het
Slitrk5 A G 14: 111,917,014 (GRCm39) K213E probably damaging Het
Smarcd1 C A 15: 99,610,065 (GRCm39) P432Q probably damaging Het
Stat4 A G 1: 52,142,145 (GRCm39) D664G probably damaging Het
Suz12 T A 11: 79,910,587 (GRCm39) W313R probably damaging Het
Sycp2 T C 2: 177,999,916 (GRCm39) Y1020C probably benign Het
Tmem181a T A 17: 6,346,061 (GRCm39) L185H probably damaging Het
Tmem81 A G 1: 132,435,752 (GRCm39) N186S probably benign Het
Tut4 G A 4: 108,370,125 (GRCm39) E714K probably damaging Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19,286,007 (GRCm39) splice site probably benign
IGL01296:Vmn2r98 APN 17 19,285,447 (GRCm39) missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19,286,020 (GRCm39) missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19,285,521 (GRCm39) missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19,286,713 (GRCm39) missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19,286,702 (GRCm39) missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19,286,702 (GRCm39) missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19,286,548 (GRCm39) missense probably benign
IGL02123:Vmn2r98 APN 17 19,300,941 (GRCm39) missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19,286,113 (GRCm39) missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19,286,083 (GRCm39) missense probably benign
IGL02650:Vmn2r98 APN 17 19,301,223 (GRCm39) missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19,285,521 (GRCm39) missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19,286,275 (GRCm39) missense probably benign
IGL02807:Vmn2r98 APN 17 19,301,283 (GRCm39) missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19,286,242 (GRCm39) missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19,290,107 (GRCm39) missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19,301,223 (GRCm39) missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19,286,662 (GRCm39) missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19,286,609 (GRCm39) missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19,286,609 (GRCm39) missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19,286,089 (GRCm39) nonsense probably null
R0545:Vmn2r98 UTSW 17 19,273,875 (GRCm39) missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19,300,759 (GRCm39) missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19,300,782 (GRCm39) missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19,301,011 (GRCm39) missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19,286,210 (GRCm39) missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19,285,440 (GRCm39) missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19,287,645 (GRCm39) missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19,301,170 (GRCm39) missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19,286,702 (GRCm39) missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19,286,680 (GRCm39) missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19,285,595 (GRCm39) nonsense probably null
R2165:Vmn2r98 UTSW 17 19,301,553 (GRCm39) missense unknown
R2238:Vmn2r98 UTSW 17 19,286,213 (GRCm39) missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19,300,698 (GRCm39) missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19,286,081 (GRCm39) missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19,301,439 (GRCm39) missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19,287,664 (GRCm39) missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19,300,887 (GRCm39) missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19,286,354 (GRCm39) missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19,290,007 (GRCm39) missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19,286,602 (GRCm39) missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19,286,419 (GRCm39) missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19,286,306 (GRCm39) missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19,273,815 (GRCm39) missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19,300,981 (GRCm39) missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19,290,016 (GRCm39) nonsense probably null
R5371:Vmn2r98 UTSW 17 19,290,015 (GRCm39) missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19,287,645 (GRCm39) missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19,301,161 (GRCm39) missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19,286,260 (GRCm39) missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19,286,336 (GRCm39) missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19,286,143 (GRCm39) missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19,286,063 (GRCm39) missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19,285,510 (GRCm39) missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19,286,530 (GRCm39) missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19,301,184 (GRCm39) missense probably benign
R7068:Vmn2r98 UTSW 17 19,285,575 (GRCm39) missense probably benign
R7607:Vmn2r98 UTSW 17 19,287,570 (GRCm39) missense possibly damaging 0.95
R7763:Vmn2r98 UTSW 17 19,300,797 (GRCm39) missense probably benign 0.00
R7771:Vmn2r98 UTSW 17 19,287,460 (GRCm39) splice site probably null
R7915:Vmn2r98 UTSW 17 19,287,493 (GRCm39) missense probably benign 0.10
R8028:Vmn2r98 UTSW 17 19,273,912 (GRCm39) missense probably benign 0.00
R8205:Vmn2r98 UTSW 17 19,301,425 (GRCm39) missense probably damaging 0.99
R8241:Vmn2r98 UTSW 17 19,301,031 (GRCm39) missense probably damaging 0.99
R8906:Vmn2r98 UTSW 17 19,286,532 (GRCm39) missense probably benign
R8952:Vmn2r98 UTSW 17 19,285,531 (GRCm39) missense possibly damaging 0.76
R9147:Vmn2r98 UTSW 17 19,286,383 (GRCm39) missense probably benign 0.04
R9148:Vmn2r98 UTSW 17 19,286,383 (GRCm39) missense probably benign 0.04
R9187:Vmn2r98 UTSW 17 19,301,481 (GRCm39) missense probably damaging 1.00
R9344:Vmn2r98 UTSW 17 19,286,777 (GRCm39) missense probably benign 0.14
R9467:Vmn2r98 UTSW 17 19,287,517 (GRCm39) missense probably benign 0.01
R9487:Vmn2r98 UTSW 17 19,301,496 (GRCm39) missense possibly damaging 0.78
R9753:Vmn2r98 UTSW 17 19,285,665 (GRCm39) missense probably benign 0.27
Z1177:Vmn2r98 UTSW 17 19,287,685 (GRCm39) nonsense probably null
Z1177:Vmn2r98 UTSW 17 19,285,398 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTTGAAACTTGCAGGCCTAAC -3'
(R):5'- CATCCATATTTTCCCAGAATTTGGC -3'

Sequencing Primer
(F):5'- GCAGGCCTAACAAAAATTTCTGTTG -3'
(R):5'- TGGCAACATATGAAGTCCATGTG -3'
Posted On 2015-01-11