Incidental Mutation 'R3004:Sox17'
ID257382
Institutional Source Beutler Lab
Gene Symbol Sox17
Ensembl Gene ENSMUSG00000025902
Gene NameSRY (sex determining region Y)-box 17
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3004 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location4490931-4497354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4492617 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 120 (E120G)
Ref Sequence ENSEMBL: ENSMUSP00000141674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027035] [ENSMUST00000116652] [ENSMUST00000191647] [ENSMUST00000191939] [ENSMUST00000192650] [ENSMUST00000192913] [ENSMUST00000195555]
Predicted Effect probably damaging
Transcript: ENSMUST00000027035
AA Change: E120G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027035
Gene: ENSMUSG00000025902
AA Change: E120G

DomainStartEndE-ValueType
HMG 67 137 1.57e-28 SMART
low complexity region 182 193 N/A INTRINSIC
Pfam:Sox_C_TAD 197 417 9.5e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116652
AA Change: E120G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112351
Gene: ENSMUSG00000025902
AA Change: E120G

DomainStartEndE-ValueType
HMG 67 137 1.57e-28 SMART
low complexity region 182 193 N/A INTRINSIC
Pfam:Sox_C_TAD 197 330 9.8e-19 PFAM
Pfam:Sox_C_TAD 312 418 1.6e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191647
AA Change: E55G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142204
Gene: ENSMUSG00000025902
AA Change: E55G

DomainStartEndE-ValueType
Pfam:HMG_box 36 71 3.7e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191939
AA Change: E120G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142154
Gene: ENSMUSG00000025902
AA Change: E120G

DomainStartEndE-ValueType
HMG 67 137 6.3e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192505
Predicted Effect probably damaging
Transcript: ENSMUST00000192650
AA Change: E55G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142116
Gene: ENSMUSG00000025902
AA Change: E55G

DomainStartEndE-ValueType
Pfam:HMG_box 36 71 2.5e-7 PFAM
low complexity region 117 128 N/A INTRINSIC
Pfam:Sox_C_TAD 132 266 6.1e-16 PFAM
Pfam:Sox_C_TAD 255 353 4.4e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000192913
AA Change: E120G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141674
Gene: ENSMUSG00000025902
AA Change: E120G

DomainStartEndE-ValueType
HMG 67 137 6.3e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194935
Predicted Effect probably benign
Transcript: ENSMUST00000195555
SMART Domains Protein: ENSMUSP00000141894
Gene: ENSMUSG00000025902

DomainStartEndE-ValueType
SCOP:d2lefa_ 1 21 6e-4 SMART
low complexity region 54 65 N/A INTRINSIC
Pfam:Sox_C_TAD 69 202 4.6e-16 PFAM
Pfam:Sox_C_TAD 192 290 3.1e-27 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Sox (Sry-related high mobility group box) family of transcription factors involved in the regulation of embryonic development. The encoded protein plays a role in the determination of cell fate and in maintaining cell identity. This gene regulates tumor angiogenesis and tumor progression. Mutations in the human gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Embryos homozygous for a targeted null mutation develop a deficient gut endoderm and die around embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 G A 7: 81,103,355 W1553* probably null Het
Art2a-ps T C 7: 101,554,765 I189V probably benign Het
BC049715 A G 6: 136,839,792 E10G possibly damaging Het
BC067074 T C 13: 113,366,154 F131S probably damaging Het
Ccdc158 A G 5: 92,649,070 L469P probably damaging Het
Ctsm T C 13: 61,539,868 I59V possibly damaging Het
Daam2 A G 17: 49,460,654 F970L probably damaging Het
Gm21903 A T 17: 39,042,656 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Hist1h2bf G A 13: 23,574,181 probably benign Het
Hoxd10 T A 2: 74,692,362 V128D probably benign Het
Ighv5-9 T C 12: 113,661,947 T59A probably benign Het
Nlrp4c G A 7: 6,065,525 V142M probably benign Het
Npc1 A G 18: 12,197,254 F947L probably benign Het
Olfr356 T A 2: 36,937,209 I30N possibly damaging Het
Olfr504 G T 7: 108,564,944 H284N probably benign Het
Piezo2 G T 18: 63,024,435 Y223* probably null Het
Rhog A T 7: 102,240,138 V36E probably damaging Het
Sbno1 G A 5: 124,381,708 T1168I probably damaging Het
Sin3a T A 9: 57,096,834 L290* probably null Het
Slco1c1 G T 6: 141,532,654 A48S probably damaging Het
Slfn9 A T 11: 82,981,764 S715R possibly damaging Het
Other mutations in Sox17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Sox17 APN 1 4492203 missense possibly damaging 0.66
rheas UTSW 1 4492432 missense possibly damaging 0.71
R1160:Sox17 UTSW 1 4491852 missense probably damaging 1.00
R1503:Sox17 UTSW 1 4491928 missense probably damaging 1.00
R2911:Sox17 UTSW 1 4493131 missense probably damaging 1.00
R3508:Sox17 UTSW 1 4492155 missense probably damaging 0.98
R4596:Sox17 UTSW 1 4492637 missense possibly damaging 0.91
R5274:Sox17 UTSW 1 4491888 missense possibly damaging 0.74
R6544:Sox17 UTSW 1 4492432 missense possibly damaging 0.71
R7496:Sox17 UTSW 1 4492327 missense probably damaging 0.96
R7704:Sox17 UTSW 1 4493672 intron probably benign
Z1088:Sox17 UTSW 1 4492302 missense probably damaging 1.00
Z1177:Sox17 UTSW 1 4492473 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCATAGTCCGAGACTGG -3'
(R):5'- GCGATCTAACACTTTCATCCG -3'

Sequencing Primer
(F):5'- AAAGAAAGCCGGGTCCTGCTC -3'
(R):5'- GAATAGGACCGGGCTTCTCAC -3'
Posted On2015-01-11