Incidental Mutation 'R3004:Olfr356'
ID257384
Institutional Source Beutler Lab
Gene Symbol Olfr356
Ensembl Gene ENSMUSG00000070943
Gene Nameolfactory receptor 356
SynonymsGA_x6K02T2NLDC-33631647-33632594, MOR134-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R3004 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location36937121-36938068 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36937209 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 30 (I30N)
Ref Sequence ENSEMBL: ENSMUSP00000092631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095021]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095021
AA Change: I30N

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000092631
Gene: ENSMUSG00000070943
AA Change: I30N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.1e-52 PFAM
Pfam:7tm_1 41 290 4.9e-19 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 G A 7: 81,103,355 W1553* probably null Het
Art2a-ps T C 7: 101,554,765 I189V probably benign Het
BC049715 A G 6: 136,839,792 E10G possibly damaging Het
BC067074 T C 13: 113,366,154 F131S probably damaging Het
Ccdc158 A G 5: 92,649,070 L469P probably damaging Het
Ctsm T C 13: 61,539,868 I59V possibly damaging Het
Daam2 A G 17: 49,460,654 F970L probably damaging Het
Gm21903 A T 17: 39,042,656 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Hist1h2bf G A 13: 23,574,181 probably benign Het
Hoxd10 T A 2: 74,692,362 V128D probably benign Het
Ighv5-9 T C 12: 113,661,947 T59A probably benign Het
Nlrp4c G A 7: 6,065,525 V142M probably benign Het
Npc1 A G 18: 12,197,254 F947L probably benign Het
Olfr504 G T 7: 108,564,944 H284N probably benign Het
Piezo2 G T 18: 63,024,435 Y223* probably null Het
Rhog A T 7: 102,240,138 V36E probably damaging Het
Sbno1 G A 5: 124,381,708 T1168I probably damaging Het
Sin3a T A 9: 57,096,834 L290* probably null Het
Slco1c1 G T 6: 141,532,654 A48S probably damaging Het
Slfn9 A T 11: 82,981,764 S715R possibly damaging Het
Sox17 T C 1: 4,492,617 E120G probably damaging Het
Other mutations in Olfr356
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02209:Olfr356 APN 2 36937505 missense probably damaging 1.00
IGL02457:Olfr356 APN 2 36937748 missense probably damaging 0.99
IGL02933:Olfr356 APN 2 36937298 missense probably damaging 1.00
IGL03304:Olfr356 APN 2 36937548 missense probably damaging 0.99
IGL03350:Olfr356 APN 2 36937583 missense probably damaging 1.00
IGL03050:Olfr356 UTSW 2 36937623 missense probably damaging 0.99
R0124:Olfr356 UTSW 2 36937256 missense possibly damaging 0.80
R1447:Olfr356 UTSW 2 36937776 missense possibly damaging 0.54
R1591:Olfr356 UTSW 2 36937978 missense probably damaging 1.00
R1651:Olfr356 UTSW 2 36937323 missense probably damaging 0.99
R1689:Olfr356 UTSW 2 36937977 missense probably damaging 1.00
R1876:Olfr356 UTSW 2 36937763 missense possibly damaging 0.80
R2132:Olfr356 UTSW 2 36937692 missense probably benign 0.00
R2308:Olfr356 UTSW 2 36937300 nonsense probably null
R4180:Olfr356 UTSW 2 36937230 missense probably damaging 0.98
R4445:Olfr356 UTSW 2 36937551 missense probably damaging 0.99
R5096:Olfr356 UTSW 2 36937803 missense possibly damaging 0.64
R5971:Olfr356 UTSW 2 36937229 missense probably benign 0.01
R5988:Olfr356 UTSW 2 36937224 missense probably damaging 1.00
R6138:Olfr356 UTSW 2 36937229 missense probably benign 0.01
R6544:Olfr356 UTSW 2 36937527 missense possibly damaging 0.68
R7206:Olfr356 UTSW 2 36937772 missense probably damaging 1.00
R7752:Olfr356 UTSW 2 36937618 missense probably damaging 0.98
R7854:Olfr356 UTSW 2 36938024 missense probably benign
R8110:Olfr356 UTSW 2 36937709 missense possibly damaging 0.80
U15987:Olfr356 UTSW 2 36937229 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTCTCAGAGAACACATAGCC -3'
(R):5'- CCTCTGAGTTTGGATGTTTACCAG -3'

Sequencing Primer
(F):5'- GCCACCAACAATTTAATGACATCTTG -3'
(R):5'- TTACCAGCATCCTAGGAACTGTGG -3'
Posted On2015-01-11