Incidental Mutation 'R3004:Ccdc158'
ID257388
Institutional Source Beutler Lab
Gene Symbol Ccdc158
Ensembl Gene ENSMUSG00000050050
Gene Namecoiled-coil domain containing 158
Synonyms4932413O14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R3004 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location92607954-92675271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92649070 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 469 (L469P)
Ref Sequence ENSEMBL: ENSMUSP00000063050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060930] [ENSMUST00000150359] [ENSMUST00000151180]
Predicted Effect probably damaging
Transcript: ENSMUST00000060930
AA Change: L469P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063050
Gene: ENSMUSG00000050050
AA Change: L469P

DomainStartEndE-ValueType
Pfam:CCDC158 1 1109 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150359
SMART Domains Protein: ENSMUSP00000123259
Gene: ENSMUSG00000050050

DomainStartEndE-ValueType
Pfam:CCDC158 1 346 1.5e-220 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151180
SMART Domains Protein: ENSMUSP00000117894
Gene: ENSMUSG00000050050

DomainStartEndE-ValueType
coiled coil region 71 105 N/A INTRINSIC
coiled coil region 127 166 N/A INTRINSIC
coiled coil region 244 343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 G A 7: 81,103,355 W1553* probably null Het
Art2a-ps T C 7: 101,554,765 I189V probably benign Het
BC049715 A G 6: 136,839,792 E10G possibly damaging Het
BC067074 T C 13: 113,366,154 F131S probably damaging Het
Ctsm T C 13: 61,539,868 I59V possibly damaging Het
Daam2 A G 17: 49,460,654 F970L probably damaging Het
Gm21903 A T 17: 39,042,656 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Hist1h2bf G A 13: 23,574,181 probably benign Het
Hoxd10 T A 2: 74,692,362 V128D probably benign Het
Ighv5-9 T C 12: 113,661,947 T59A probably benign Het
Nlrp4c G A 7: 6,065,525 V142M probably benign Het
Npc1 A G 18: 12,197,254 F947L probably benign Het
Olfr356 T A 2: 36,937,209 I30N possibly damaging Het
Olfr504 G T 7: 108,564,944 H284N probably benign Het
Piezo2 G T 18: 63,024,435 Y223* probably null Het
Rhog A T 7: 102,240,138 V36E probably damaging Het
Sbno1 G A 5: 124,381,708 T1168I probably damaging Het
Sin3a T A 9: 57,096,834 L290* probably null Het
Slco1c1 G T 6: 141,532,654 A48S probably damaging Het
Slfn9 A T 11: 82,981,764 S715R possibly damaging Het
Sox17 T C 1: 4,492,617 E120G probably damaging Het
Other mutations in Ccdc158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Ccdc158 APN 5 92657881 missense probably benign 0.01
IGL00926:Ccdc158 APN 5 92650767 missense probably damaging 0.98
IGL01533:Ccdc158 APN 5 92609956 splice site probably null
IGL01551:Ccdc158 APN 5 92666761 missense probably damaging 0.96
IGL01591:Ccdc158 APN 5 92662041 missense probably benign 0.28
IGL01722:Ccdc158 APN 5 92662739 missense possibly damaging 0.93
IGL02250:Ccdc158 APN 5 92608478 missense probably damaging 1.00
IGL02457:Ccdc158 APN 5 92650048 missense probably damaging 1.00
IGL02570:Ccdc158 APN 5 92649026 missense possibly damaging 0.81
IGL02951:Ccdc158 APN 5 92650006 missense probably damaging 1.00
IGL03275:Ccdc158 APN 5 92629632 missense probably benign 0.00
R0238:Ccdc158 UTSW 5 92662118 missense probably benign 0.31
R0238:Ccdc158 UTSW 5 92662118 missense probably benign 0.31
R0747:Ccdc158 UTSW 5 92633297 missense probably benign 0.00
R1219:Ccdc158 UTSW 5 92654181 splice site probably benign
R1480:Ccdc158 UTSW 5 92649044 missense probably damaging 1.00
R1926:Ccdc158 UTSW 5 92650788 missense probably benign 0.41
R2172:Ccdc158 UTSW 5 92632508 missense probably damaging 1.00
R2245:Ccdc158 UTSW 5 92609952 unclassified probably benign
R3147:Ccdc158 UTSW 5 92657963 missense probably damaging 1.00
R3693:Ccdc158 UTSW 5 92610045 missense probably damaging 1.00
R3694:Ccdc158 UTSW 5 92610045 missense probably damaging 1.00
R3735:Ccdc158 UTSW 5 92632424 missense possibly damaging 0.60
R3736:Ccdc158 UTSW 5 92632424 missense possibly damaging 0.60
R3912:Ccdc158 UTSW 5 92648935 missense possibly damaging 0.90
R4026:Ccdc158 UTSW 5 92643807 missense probably benign 0.07
R4080:Ccdc158 UTSW 5 92623396 missense probably benign 0.00
R4463:Ccdc158 UTSW 5 92634300 missense probably null 0.99
R4483:Ccdc158 UTSW 5 92633328 missense probably benign 0.01
R4859:Ccdc158 UTSW 5 92633403 missense probably damaging 0.99
R5016:Ccdc158 UTSW 5 92657892 missense probably benign 0.01
R5050:Ccdc158 UTSW 5 92666879 missense probably benign 0.01
R5372:Ccdc158 UTSW 5 92632560 missense possibly damaging 0.55
R5427:Ccdc158 UTSW 5 92648962 missense probably damaging 1.00
R5847:Ccdc158 UTSW 5 92627480 missense probably benign 0.00
R5966:Ccdc158 UTSW 5 92650049 missense probably damaging 1.00
R6106:Ccdc158 UTSW 5 92627466 missense probably benign
R6185:Ccdc158 UTSW 5 92666854 missense possibly damaging 0.73
R6562:Ccdc158 UTSW 5 92662722 missense probably damaging 0.99
R6743:Ccdc158 UTSW 5 92662146 missense probably benign 0.08
R6815:Ccdc158 UTSW 5 92612486 missense probably damaging 0.99
R6914:Ccdc158 UTSW 5 92662070 missense probably benign 0.00
R6975:Ccdc158 UTSW 5 92666720 nonsense probably null
R7252:Ccdc158 UTSW 5 92650788 missense probably benign 0.41
R7477:Ccdc158 UTSW 5 92650696 missense probably damaging 0.96
R7782:Ccdc158 UTSW 5 92645514 missense probably benign 0.00
R8014:Ccdc158 UTSW 5 92649030 missense probably damaging 1.00
R8018:Ccdc158 UTSW 5 92623401 missense possibly damaging 0.64
X0025:Ccdc158 UTSW 5 92662012 missense probably benign
Z1176:Ccdc158 UTSW 5 92608491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAGGTGATCGCCCTCATTC -3'
(R):5'- TTAGGCTATTTGAACTGTTCAGTTC -3'

Sequencing Primer
(F):5'- TTGAAGCTCCTGCAACTTCAAG -3'
(R):5'- GAACTGTTCAGTTCAGGATTTCATGC -3'
Posted On2015-01-11