Incidental Mutation 'R3004:Sbno1'
ID257389
Institutional Source Beutler Lab
Gene Symbol Sbno1
Ensembl Gene ENSMUSG00000038095
Gene Namestrawberry notch 1
Synonyms9330180L10Rik, sno
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3004 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location124368702-124426001 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 124381708 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1168 (T1168I)
Ref Sequence ENSEMBL: ENSMUSP00000130860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065263] [ENSMUST00000168651] [ENSMUST00000199808]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065263
AA Change: T1169I

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066808
Gene: ENSMUSG00000038095
AA Change: T1169I

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 254 559 3.6e-144 PFAM
Pfam:ResIII 287 478 2.7e-8 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 3.6e-126 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168651
AA Change: T1168I

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130860
Gene: ENSMUSG00000038095
AA Change: T1168I

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 254 559 3.6e-144 PFAM
Pfam:ResIII 287 478 2.7e-8 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 3.6e-126 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199245
Predicted Effect possibly damaging
Transcript: ENSMUST00000199808
AA Change: T1169I

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142481
Gene: ENSMUSG00000038095
AA Change: T1169I

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 252 560 6e-139 PFAM
Pfam:ResIII 289 476 1.3e-7 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 4.6e-120 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 G A 7: 81,103,355 W1553* probably null Het
Art2a-ps T C 7: 101,554,765 I189V probably benign Het
BC049715 A G 6: 136,839,792 E10G possibly damaging Het
BC067074 T C 13: 113,366,154 F131S probably damaging Het
Ccdc158 A G 5: 92,649,070 L469P probably damaging Het
Ctsm T C 13: 61,539,868 I59V possibly damaging Het
Daam2 A G 17: 49,460,654 F970L probably damaging Het
Gm21903 A T 17: 39,042,656 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Hist1h2bf G A 13: 23,574,181 probably benign Het
Hoxd10 T A 2: 74,692,362 V128D probably benign Het
Ighv5-9 T C 12: 113,661,947 T59A probably benign Het
Nlrp4c G A 7: 6,065,525 V142M probably benign Het
Npc1 A G 18: 12,197,254 F947L probably benign Het
Olfr356 T A 2: 36,937,209 I30N possibly damaging Het
Olfr504 G T 7: 108,564,944 H284N probably benign Het
Piezo2 G T 18: 63,024,435 Y223* probably null Het
Rhog A T 7: 102,240,138 V36E probably damaging Het
Sin3a T A 9: 57,096,834 L290* probably null Het
Slco1c1 G T 6: 141,532,654 A48S probably damaging Het
Slfn9 A T 11: 82,981,764 S715R possibly damaging Het
Sox17 T C 1: 4,492,617 E120G probably damaging Het
Other mutations in Sbno1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Sbno1 APN 5 124402205 missense probably damaging 1.00
IGL01154:Sbno1 APN 5 124410249 missense probably damaging 1.00
IGL01309:Sbno1 APN 5 124381706 missense probably benign 0.41
IGL01330:Sbno1 APN 5 124391979 missense probably damaging 1.00
IGL01541:Sbno1 APN 5 124378555 splice site probably benign
IGL01800:Sbno1 APN 5 124381505 splice site probably benign
IGL01987:Sbno1 APN 5 124404219 missense probably damaging 1.00
IGL02178:Sbno1 APN 5 124400195 splice site probably null
IGL02544:Sbno1 APN 5 124403983 missense probably damaging 0.99
IGL02572:Sbno1 APN 5 124381677 splice site probably benign
IGL02592:Sbno1 APN 5 124400809 missense probably damaging 1.00
IGL03033:Sbno1 APN 5 124376150 missense probably damaging 0.97
IGL03089:Sbno1 APN 5 124387311 splice site probably benign
IGL03131:Sbno1 APN 5 124388605 missense probably damaging 1.00
Decrement UTSW 5 124400847 missense probably damaging 1.00
R0200:Sbno1 UTSW 5 124384541 missense probably damaging 1.00
R0217:Sbno1 UTSW 5 124404324 critical splice acceptor site probably null
R0233:Sbno1 UTSW 5 124376226 missense probably damaging 1.00
R0233:Sbno1 UTSW 5 124376226 missense probably damaging 1.00
R0334:Sbno1 UTSW 5 124386868 missense possibly damaging 0.79
R0401:Sbno1 UTSW 5 124410285 missense probably damaging 0.96
R0608:Sbno1 UTSW 5 124384541 missense probably damaging 1.00
R0615:Sbno1 UTSW 5 124410139 missense probably damaging 1.00
R0653:Sbno1 UTSW 5 124386892 missense possibly damaging 0.79
R0655:Sbno1 UTSW 5 124376149 missense possibly damaging 0.95
R1037:Sbno1 UTSW 5 124393912 missense possibly damaging 0.92
R1439:Sbno1 UTSW 5 124384460 splice site probably benign
R1522:Sbno1 UTSW 5 124392612 missense probably damaging 1.00
R1590:Sbno1 UTSW 5 124384504 missense possibly damaging 0.55
R1618:Sbno1 UTSW 5 124404216 missense probably damaging 1.00
R1671:Sbno1 UTSW 5 124392067 splice site probably null
R1779:Sbno1 UTSW 5 124388517 unclassified probably benign
R2103:Sbno1 UTSW 5 124393937 missense probably damaging 0.98
R2136:Sbno1 UTSW 5 124387534 synonymous probably null
R2149:Sbno1 UTSW 5 124402119 synonymous probably null
R2153:Sbno1 UTSW 5 124378543 missense probably benign
R2154:Sbno1 UTSW 5 124378511 missense probably benign
R2231:Sbno1 UTSW 5 124405704 missense probably damaging 1.00
R2879:Sbno1 UTSW 5 124388572 missense probably damaging 1.00
R3922:Sbno1 UTSW 5 124381930 missense probably damaging 1.00
R4061:Sbno1 UTSW 5 124388572 missense probably damaging 1.00
R4096:Sbno1 UTSW 5 124391920 critical splice donor site probably null
R4612:Sbno1 UTSW 5 124404024 missense probably damaging 1.00
R4879:Sbno1 UTSW 5 124404024 missense probably damaging 1.00
R4937:Sbno1 UTSW 5 124374609 missense possibly damaging 0.93
R4990:Sbno1 UTSW 5 124400165 missense probably damaging 1.00
R5341:Sbno1 UTSW 5 124408475 critical splice donor site probably null
R5365:Sbno1 UTSW 5 124381866 frame shift probably null
R5399:Sbno1 UTSW 5 124392741 missense probably benign 0.09
R5704:Sbno1 UTSW 5 124395893 critical splice donor site probably null
R5898:Sbno1 UTSW 5 124386791 intron probably benign
R6136:Sbno1 UTSW 5 124378491 missense probably benign 0.41
R6154:Sbno1 UTSW 5 124378479 missense possibly damaging 0.94
R6412:Sbno1 UTSW 5 124392714 missense probably damaging 0.99
R6414:Sbno1 UTSW 5 124395931 missense probably benign 0.28
R6454:Sbno1 UTSW 5 124400847 missense probably damaging 1.00
R7085:Sbno1 UTSW 5 124381720 missense possibly damaging 0.83
R7176:Sbno1 UTSW 5 124392881 missense probably benign 0.21
R7219:Sbno1 UTSW 5 124405659 missense probably benign 0.00
R7535:Sbno1 UTSW 5 124413279 missense possibly damaging 0.48
R7673:Sbno1 UTSW 5 124413216 missense probably benign
R7692:Sbno1 UTSW 5 124405646 missense probably benign 0.35
R7745:Sbno1 UTSW 5 124392899 missense probably benign 0.00
R7762:Sbno1 UTSW 5 124374666 missense probably benign 0.19
R8012:Sbno1 UTSW 5 124384502 missense probably benign 0.43
R8142:Sbno1 UTSW 5 124408545 missense probably benign
R8164:Sbno1 UTSW 5 124374621 missense probably benign 0.13
R8168:Sbno1 UTSW 5 124402055 critical splice donor site probably benign
R8206:Sbno1 UTSW 5 124402055 critical splice donor site probably benign
R8259:Sbno1 UTSW 5 124381696 missense probably damaging 0.99
R8289:Sbno1 UTSW 5 124404005 missense probably damaging 1.00
Z1088:Sbno1 UTSW 5 124393958 missense possibly damaging 0.91
Z1088:Sbno1 UTSW 5 124404304 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGTCAGCTCTGCCCAAATC -3'
(R):5'- GCTGTTTCAGTATTTTGCAGACAC -3'

Sequencing Primer
(F):5'- AAATCTTGGTTGCTTCCTCCCAG -3'
(R):5'- CTGCAGTTGTTCAGAATGCCAAG -3'
Posted On2015-01-11