Incidental Mutation 'R3004:BC049715'
ID257390
Institutional Source Beutler Lab
Gene Symbol BC049715
Ensembl Gene ENSMUSG00000047515
Gene NamecDNA sequence BC049715
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3004 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location136827626-136840662 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136839792 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 10 (E10G)
Ref Sequence ENSEMBL: ENSMUSP00000145015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052702] [ENSMUST00000068293] [ENSMUST00000111894] [ENSMUST00000163640] [ENSMUST00000203468] [ENSMUST00000203499] [ENSMUST00000204086]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052702
AA Change: E10G

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049512
Gene: ENSMUSG00000047515
AA Change: E10G

DomainStartEndE-ValueType
Pfam:DUF4533 8 235 1.3e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068293
SMART Domains Protein: ENSMUSP00000066235
Gene: ENSMUSG00000043298

DomainStartEndE-ValueType
Pfam:DUF4533 14 221 1.9e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111894
SMART Domains Protein: ENSMUSP00000107525
Gene: ENSMUSG00000043298

DomainStartEndE-ValueType
Pfam:DUF4533 14 221 2.4e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163640
AA Change: E10G

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133266
Gene: ENSMUSG00000047515
AA Change: E10G

DomainStartEndE-ValueType
Pfam:DUF4533 8 235 1.6e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203468
SMART Domains Protein: ENSMUSP00000144838
Gene: ENSMUSG00000043298

DomainStartEndE-ValueType
Pfam:DUF4533 14 221 2.4e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203499
AA Change: E10G

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000145015
Gene: ENSMUSG00000047515
AA Change: E10G

DomainStartEndE-ValueType
Pfam:DUF4533 8 235 1.6e-97 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000204086
AA Change: E10G
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 G A 7: 81,103,355 W1553* probably null Het
Art2a-ps T C 7: 101,554,765 I189V probably benign Het
BC067074 T C 13: 113,366,154 F131S probably damaging Het
Ccdc158 A G 5: 92,649,070 L469P probably damaging Het
Ctsm T C 13: 61,539,868 I59V possibly damaging Het
Daam2 A G 17: 49,460,654 F970L probably damaging Het
Gm21903 A T 17: 39,042,656 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Hist1h2bf G A 13: 23,574,181 probably benign Het
Hoxd10 T A 2: 74,692,362 V128D probably benign Het
Ighv5-9 T C 12: 113,661,947 T59A probably benign Het
Nlrp4c G A 7: 6,065,525 V142M probably benign Het
Npc1 A G 18: 12,197,254 F947L probably benign Het
Olfr356 T A 2: 36,937,209 I30N possibly damaging Het
Olfr504 G T 7: 108,564,944 H284N probably benign Het
Piezo2 G T 18: 63,024,435 Y223* probably null Het
Rhog A T 7: 102,240,138 V36E probably damaging Het
Sbno1 G A 5: 124,381,708 T1168I probably damaging Het
Sin3a T A 9: 57,096,834 L290* probably null Het
Slco1c1 G T 6: 141,532,654 A48S probably damaging Het
Slfn9 A T 11: 82,981,764 S715R possibly damaging Het
Sox17 T C 1: 4,492,617 E120G probably damaging Het
Other mutations in BC049715
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:BC049715 APN 6 136840095 missense possibly damaging 0.80
IGL01834:BC049715 APN 6 136840491 missense probably benign 0.26
R0330:BC049715 UTSW 6 136840037 missense possibly damaging 0.95
R0375:BC049715 UTSW 6 136839996 missense probably benign 0.12
R0419:BC049715 UTSW 6 136840145 missense possibly damaging 0.71
R1437:BC049715 UTSW 6 136840092 missense probably damaging 0.99
R1734:BC049715 UTSW 6 136840308 missense probably damaging 1.00
R1737:BC049715 UTSW 6 136840308 missense probably damaging 1.00
R1738:BC049715 UTSW 6 136840308 missense probably damaging 1.00
R2264:BC049715 UTSW 6 136840436 nonsense probably null
R3937:BC049715 UTSW 6 136840455 missense possibly damaging 0.93
R3938:BC049715 UTSW 6 136840455 missense possibly damaging 0.93
R4459:BC049715 UTSW 6 136840052 missense probably damaging 0.99
R4806:BC049715 UTSW 6 136839929 missense possibly damaging 0.93
R5086:BC049715 UTSW 6 136840431 missense probably damaging 1.00
R6280:BC049715 UTSW 6 136840231 nonsense probably null
R7383:BC049715 UTSW 6 136840455 missense probably damaging 0.98
R7554:BC049715 UTSW 6 136840297 missense probably damaging 0.99
R8055:BC049715 UTSW 6 136839915 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGCCCAGAGTCATATGTACTTTGTC -3'
(R):5'- TTAGAGCACAACGGCTCCTTC -3'

Sequencing Primer
(F):5'- CACCCTTGTCAAGACTTAGCTTGG -3'
(R):5'- ACAACGGCTCCTTCTGCATTTG -3'
Posted On2015-01-11