Incidental Mutation 'R3004:Rhog'
ID257394
Institutional Source Beutler Lab
Gene Symbol Rhog
Ensembl Gene ENSMUSG00000073982
Gene Nameras homolog family member G
SynonymsRhoG, Sid10750, Arhg, 2810426G09Rik
Accession Numbers
Is this an essential gene? Not available question?
Stock #R3004 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102239123-102256054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102240138 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 36 (V36E)
Ref Sequence ENSEMBL: ENSMUSP00000147985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033292] [ENSMUST00000098230] [ENSMUST00000106923] [ENSMUST00000119816] [ENSMUST00000120119] [ENSMUST00000120879] [ENSMUST00000126914] [ENSMUST00000129340] [ENSMUST00000138479] [ENSMUST00000138753] [ENSMUST00000140058] [ENSMUST00000142873] [ENSMUST00000143541] [ENSMUST00000145352] [ENSMUST00000153020] [ENSMUST00000156529] [ENSMUST00000209968]
Predicted Effect probably benign
Transcript: ENSMUST00000033292
SMART Domains Protein: ENSMUSP00000033292
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 241 2e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098230
AA Change: V36E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095832
Gene: ENSMUSG00000073982
AA Change: V36E

DomainStartEndE-ValueType
RHO 6 179 1.87e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106923
AA Change: V36E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102536
Gene: ENSMUSG00000073982
AA Change: V36E

DomainStartEndE-ValueType
RHO 6 179 1.87e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119816
SMART Domains Protein: ENSMUSP00000113261
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120119
SMART Domains Protein: ENSMUSP00000113574
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 16 239 1.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120879
SMART Domains Protein: ENSMUSP00000114016
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 237 7.2e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126914
SMART Domains Protein: ENSMUSP00000114853
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 101 6.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127804
Predicted Effect probably benign
Transcript: ENSMUST00000129340
SMART Domains Protein: ENSMUSP00000119692
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134621
Predicted Effect probably benign
Transcript: ENSMUST00000138479
SMART Domains Protein: ENSMUSP00000115590
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 209 5.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138753
SMART Domains Protein: ENSMUSP00000116858
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 123 9.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140058
SMART Domains Protein: ENSMUSP00000122482
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142873
SMART Domains Protein: ENSMUSP00000121988
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 136 3.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143541
SMART Domains Protein: ENSMUSP00000117450
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 79 2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143759
Predicted Effect probably benign
Transcript: ENSMUST00000145352
SMART Domains Protein: ENSMUSP00000123523
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150891
Predicted Effect probably benign
Transcript: ENSMUST00000153020
SMART Domains Protein: ENSMUSP00000123570
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 209 5.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156529
SMART Domains Protein: ENSMUSP00000121521
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 237 7.2e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209968
AA Change: V36E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214560
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho family of small GTPases, which cycle between inactive GDP-bound and active GTP-bound states and function as molecular switches in signal transduction cascades. Rho proteins promote reorganization of the actin cytoskeleton and regulate cell shape, attachment, and motility. The encoded protein facilitates translocation of a functional guanine nucleotide exchange factor (GEF) complex from the cytoplasm to the plasma membrane where ras-related C3 botulinum toxin substrate 1 is activated to promote lamellipodium formation and cell migration. Two related pseudogene have been identified on chromosomes 20 and X. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display and essentially normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 G A 7: 81,103,355 W1553* probably null Het
Art2a-ps T C 7: 101,554,765 I189V probably benign Het
BC049715 A G 6: 136,839,792 E10G possibly damaging Het
BC067074 T C 13: 113,366,154 F131S probably damaging Het
Ccdc158 A G 5: 92,649,070 L469P probably damaging Het
Ctsm T C 13: 61,539,868 I59V possibly damaging Het
Daam2 A G 17: 49,460,654 F970L probably damaging Het
Gm21903 A T 17: 39,042,656 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Hist1h2bf G A 13: 23,574,181 probably benign Het
Hoxd10 T A 2: 74,692,362 V128D probably benign Het
Ighv5-9 T C 12: 113,661,947 T59A probably benign Het
Nlrp4c G A 7: 6,065,525 V142M probably benign Het
Npc1 A G 18: 12,197,254 F947L probably benign Het
Olfr356 T A 2: 36,937,209 I30N possibly damaging Het
Olfr504 G T 7: 108,564,944 H284N probably benign Het
Piezo2 G T 18: 63,024,435 Y223* probably null Het
Sbno1 G A 5: 124,381,708 T1168I probably damaging Het
Sin3a T A 9: 57,096,834 L290* probably null Het
Slco1c1 G T 6: 141,532,654 A48S probably damaging Het
Slfn9 A T 11: 82,981,764 S715R possibly damaging Het
Sox17 T C 1: 4,492,617 E120G probably damaging Het
Other mutations in Rhog
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1224:Rhog UTSW 7 102239752 missense possibly damaging 0.78
R4867:Rhog UTSW 7 102240150 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACGTTCTCATAGGAGGGTG -3'
(R):5'- TCTCAGTAGGTACAGGTCTCC -3'

Sequencing Primer
(F):5'- CTCATAGGAGGGTGGACTGGC -3'
(R):5'- CTCAGTAGGTACAGGTCTCCTAAATC -3'
Posted On2015-01-11