Incidental Mutation 'R3004:Olfr504'
ID257395
Institutional Source Beutler Lab
Gene Symbol Olfr504
Ensembl Gene ENSMUSG00000060105
Gene Nameolfactory receptor 504
SynonymsGA_x6K02T2PBJ9-10895499-10894543, MOR40-15, MOR40-7P
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R3004 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108564836-108565793 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 108564944 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 284 (H284N)
Ref Sequence ENSEMBL: ENSMUSP00000075025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075595]
Predicted Effect probably benign
Transcript: ENSMUST00000075595
AA Change: H284N

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075025
Gene: ENSMUSG00000060105
AA Change: H284N

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 3.9e-70 PFAM
Pfam:7TM_GPCR_Srsx 40 311 5.1e-10 PFAM
Pfam:7tm_1 47 296 3.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207199
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207240
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 G A 7: 81,103,355 W1553* probably null Het
Art2a-ps T C 7: 101,554,765 I189V probably benign Het
BC049715 A G 6: 136,839,792 E10G possibly damaging Het
BC067074 T C 13: 113,366,154 F131S probably damaging Het
Ccdc158 A G 5: 92,649,070 L469P probably damaging Het
Ctsm T C 13: 61,539,868 I59V possibly damaging Het
Daam2 A G 17: 49,460,654 F970L probably damaging Het
Gm21903 A T 17: 39,042,656 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Hist1h2bf G A 13: 23,574,181 probably benign Het
Hoxd10 T A 2: 74,692,362 V128D probably benign Het
Ighv5-9 T C 12: 113,661,947 T59A probably benign Het
Nlrp4c G A 7: 6,065,525 V142M probably benign Het
Npc1 A G 18: 12,197,254 F947L probably benign Het
Olfr356 T A 2: 36,937,209 I30N possibly damaging Het
Piezo2 G T 18: 63,024,435 Y223* probably null Het
Rhog A T 7: 102,240,138 V36E probably damaging Het
Sbno1 G A 5: 124,381,708 T1168I probably damaging Het
Sin3a T A 9: 57,096,834 L290* probably null Het
Slco1c1 G T 6: 141,532,654 A48S probably damaging Het
Slfn9 A T 11: 82,981,764 S715R possibly damaging Het
Sox17 T C 1: 4,492,617 E120G probably damaging Het
Other mutations in Olfr504
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Olfr504 APN 7 108565202 missense probably benign 0.02
IGL01447:Olfr504 APN 7 108565009 missense possibly damaging 0.75
IGL01845:Olfr504 APN 7 108565136 missense possibly damaging 0.76
IGL02110:Olfr504 APN 7 108565079 missense probably damaging 1.00
IGL03196:Olfr504 APN 7 108564854 missense probably benign
R0282:Olfr504 UTSW 7 108565477 missense probably damaging 1.00
R0359:Olfr504 UTSW 7 108565514 missense probably benign 0.01
R0514:Olfr504 UTSW 7 108565672 missense probably damaging 1.00
R0727:Olfr504 UTSW 7 108565108 missense probably benign 0.00
R0744:Olfr504 UTSW 7 108564998 missense possibly damaging 0.57
R0836:Olfr504 UTSW 7 108564998 missense possibly damaging 0.57
R0840:Olfr504 UTSW 7 108565616 missense probably benign 0.00
R0883:Olfr504 UTSW 7 108565276 missense probably benign 0.01
R1750:Olfr504 UTSW 7 108565357 nonsense probably null
R1827:Olfr504 UTSW 7 108565075 missense probably benign 0.35
R1933:Olfr504 UTSW 7 108565523 missense possibly damaging 0.57
R3766:Olfr504 UTSW 7 108565195 missense probably benign 0.00
R5179:Olfr504 UTSW 7 108565226 missense probably benign
R5408:Olfr504 UTSW 7 108565169 missense probably damaging 0.99
R5493:Olfr504 UTSW 7 108565567 missense probably benign 0.24
R5569:Olfr504 UTSW 7 108565565 missense probably benign 0.01
R6520:Olfr504 UTSW 7 108564839 makesense probably null
R6798:Olfr504 UTSW 7 108565760 nonsense probably null
R6803:Olfr504 UTSW 7 108565413 missense probably damaging 1.00
R7242:Olfr504 UTSW 7 108565712 missense probably benign 0.03
R7559:Olfr504 UTSW 7 108565556 missense probably damaging 0.99
R7644:Olfr504 UTSW 7 108565442 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AAGGGATGCTTCGAAGGCAC -3'
(R):5'- AATGGGGAGTGAACTGGGTCTC -3'

Sequencing Primer
(F):5'- AATTCCCCTCCATCATATCTAGAATG -3'
(R):5'- GTGAACTGGGTCTCATAATATTGTC -3'
Posted On2015-01-11