Incidental Mutation 'R3004:Hist1h2bf'
ID257398
Institutional Source Beutler Lab
Gene Symbol Hist1h2bf
Ensembl Gene ENSMUSG00000069268
Gene Namehistone cluster 1, H2bf
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R3004 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23573736-23574196 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 23574181 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000100737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079251] [ENSMUST00000090776] [ENSMUST00000102969] [ENSMUST00000105105] [ENSMUST00000105106]
PDB Structure
Crystal structure of RAG2-PHD finger in complex with H3R2me2aK4me3 peptide [X-RAY DIFFRACTION]
Crystal structure of RAG2-PHD finger in complex with H3R2me2sK4me3 peptide [X-RAY DIFFRACTION]
Crystal structure of RAG2-PHD finger in complex with H3R2me2sK4me2 peptide [X-RAY DIFFRACTION]
Histone demethylase KDM2A-H3K36ME1-alpha-KG complex structure [X-RAY DIFFRACTION]
Crystal structure of histone demethylase kdm2a-h3k36me2 with alpha-kg [X-RAY DIFFRACTION]
Crystal structure of histone demethylase kdm2a-h3k36me3 complex with alpha-kg [X-RAY DIFFRACTION]
crystal structure of histone demethylase KDM2A-H3K36ME3 with NOG [X-RAY DIFFRACTION]
Crystal structure of histone demethylase KDM2A-H3K36ME2 with NOG [X-RAY DIFFRACTION]
Crystal structure of histone demethylase KDM2A-H3K36ME1 with NOG [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000079251
SMART Domains Protein: ENSMUSP00000078239
Gene: ENSMUSG00000058385

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090776
SMART Domains Protein: ENSMUSP00000088281
Gene: ENSMUSG00000071478

DomainStartEndE-ValueType
H2A 3 123 8.07e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102969
SMART Domains Protein: ENSMUSP00000100034
Gene: ENSMUSG00000069272

DomainStartEndE-ValueType
H2A 3 123 8.07e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105105
SMART Domains Protein: ENSMUSP00000100737
Gene: ENSMUSG00000099583

DomainStartEndE-ValueType
H3 34 136 2.12e-75 SMART
Predicted Effect unknown
Transcript: ENSMUST00000105106
AA Change: P4S
SMART Domains Protein: ENSMUSP00000100738
Gene: ENSMUSG00000069268
AA Change: P4S

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 4.64e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200671
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 G A 7: 81,103,355 W1553* probably null Het
Art2a-ps T C 7: 101,554,765 I189V probably benign Het
BC049715 A G 6: 136,839,792 E10G possibly damaging Het
BC067074 T C 13: 113,366,154 F131S probably damaging Het
Ccdc158 A G 5: 92,649,070 L469P probably damaging Het
Ctsm T C 13: 61,539,868 I59V possibly damaging Het
Daam2 A G 17: 49,460,654 F970L probably damaging Het
Gm21903 A T 17: 39,042,656 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Hoxd10 T A 2: 74,692,362 V128D probably benign Het
Ighv5-9 T C 12: 113,661,947 T59A probably benign Het
Nlrp4c G A 7: 6,065,525 V142M probably benign Het
Npc1 A G 18: 12,197,254 F947L probably benign Het
Olfr356 T A 2: 36,937,209 I30N possibly damaging Het
Olfr504 G T 7: 108,564,944 H284N probably benign Het
Piezo2 G T 18: 63,024,435 Y223* probably null Het
Rhog A T 7: 102,240,138 V36E probably damaging Het
Sbno1 G A 5: 124,381,708 T1168I probably damaging Het
Sin3a T A 9: 57,096,834 L290* probably null Het
Slco1c1 G T 6: 141,532,654 A48S probably damaging Het
Slfn9 A T 11: 82,981,764 S715R possibly damaging Het
Sox17 T C 1: 4,492,617 E120G probably damaging Het
Other mutations in Hist1h2bf
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4610:Hist1h2bf UTSW 13 23574057 missense possibly damaging 0.87
R5997:Hist1h2bf UTSW 13 23574103 unclassified probably benign
R6131:Hist1h2bf UTSW 13 23574136 unclassified probably benign
R7873:Hist1h2bf UTSW 13 23574070 missense probably damaging 1.00
R7956:Hist1h2bf UTSW 13 23574070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTTGTAATGCGCCAGGC -3'
(R):5'- CCAATGAGAAGCATTCGGGG -3'

Sequencing Primer
(F):5'- GTTCACAAACGAGTTCATGATGCC -3'
(R):5'- GCGCACGTTGATTGGGC -3'
Posted On2015-01-11