Incidental Mutation 'R3004:Gm21903'
ID257401
Institutional Source Beutler Lab
Gene Symbol Gm21903
Ensembl Gene ENSMUSG00000094168
Gene Namepredicted gene, 21903
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #R3004 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location39042634-39043341 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 39042656 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178039] [ENSMUST00000180245]
Predicted Effect unknown
Transcript: ENSMUST00000178039
AA Change: V23D
Predicted Effect probably benign
Transcript: ENSMUST00000180245
SMART Domains Protein: ENSMUSP00000137640
Gene: ENSMUSG00000095625

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ESP 24 63 3e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 G A 7: 81,103,355 W1553* probably null Het
Art2a-ps T C 7: 101,554,765 I189V probably benign Het
BC049715 A G 6: 136,839,792 E10G possibly damaging Het
BC067074 T C 13: 113,366,154 F131S probably damaging Het
Ccdc158 A G 5: 92,649,070 L469P probably damaging Het
Ctsm T C 13: 61,539,868 I59V possibly damaging Het
Daam2 A G 17: 49,460,654 F970L probably damaging Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Hist1h2bf G A 13: 23,574,181 probably benign Het
Hoxd10 T A 2: 74,692,362 V128D probably benign Het
Ighv5-9 T C 12: 113,661,947 T59A probably benign Het
Nlrp4c G A 7: 6,065,525 V142M probably benign Het
Npc1 A G 18: 12,197,254 F947L probably benign Het
Olfr356 T A 2: 36,937,209 I30N possibly damaging Het
Olfr504 G T 7: 108,564,944 H284N probably benign Het
Piezo2 G T 18: 63,024,435 Y223* probably null Het
Rhog A T 7: 102,240,138 V36E probably damaging Het
Sbno1 G A 5: 124,381,708 T1168I probably damaging Het
Sin3a T A 9: 57,096,834 L290* probably null Het
Slco1c1 G T 6: 141,532,654 A48S probably damaging Het
Slfn9 A T 11: 82,981,764 S715R possibly damaging Het
Sox17 T C 1: 4,492,617 E120G probably damaging Het
Predicted Primers PCR Primer
(F):5'- GAGATAGGACACCCAAATGACT -3'
(R):5'- GGAAACATGAAAGTCTCCCTATGAA -3'

Sequencing Primer
(F):5'- ACCCAAATGACTAACACTATTTCTC -3'
(R):5'- GAAAGTCTCCCTATGAATGAAATTGC -3'
Posted On2015-01-11