Mutagenetix > Incidental Mutations

Incidental Mutation 'R3004:Npc1'

257403

Institutional Source

Beutler Lab

Gene Symbol

Npc1

Ensembl Gene

ENSMUSG00000024413

Gene Name

NPC intracellular cholesterol transporter 1

Synonyms

nmf164, A430089E03Rik, D18Ertd723e, C85354, D18Ertd139e, lcsd

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.506) question?

Stock #

R3004 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12189693-12236400 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12197254 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 947 (F947L)

Ref Sequence

ENSEMBL: ENSMUSP00000025279 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025279]

Predicted Effect

probably benign
Transcript: ENSMUST00000025279
AA Change: F947L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000025279
Gene: ENSMUSG00000024413
AA Change: F947L

Domain	Start	End	E-Value	Type
low complexity region	8	15	N/A	INTRINSIC
Pfam:NPC1_N	22	267	1.6e-79	PFAM
transmembrane domain	269	291	N/A	INTRINSIC
transmembrane domain	353	375	N/A	INTRINSIC
Pfam:Patched	436	896	3.5e-52	PFAM
Pfam:MMPL	648	794	6.3e-8	PFAM
Pfam:Sterol-sensing	649	803	2.7e-56	PFAM
Pfam:Patched	1023	1252	2.9e-33	PFAM
low complexity region	1259	1273	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153352

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that resides in the limiting membrane of endosomes and lysosomes and mediates intracellular cholesterol trafficking via binding of cholesterol to its N-terminal domain. It is predicted to have a cytoplasmic C-terminus, 13 transmembrane domains, and 3 large loops in the lumen of the endosome - the last loop being at the N-terminus. This protein transports low-density lipoproteins to late endosomal/lysosomal compartments where they are hydrolized and released as free cholesterol. Defects in this gene cause Niemann-Pick type C disease, a rare autosomal recessive neurodegenerative disorder characterized by over accumulation of cholesterol and glycosphingolipids in late endosomal/lysosomal compartments.[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for spontaneous and chemically induced mutations may exhibit lysosomal storage of non-esterified cholesterol, neurodegeneration, ataxia, presence of foam cells, sterility, and shortened lifespan. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alpk3	G	A	7: 81,103,355	W1553*	probably null	Het
Art2a-ps	T	C	7: 101,554,765	I189V	probably benign	Het
BC049715	A	G	6: 136,839,792	E10G	possibly damaging	Het
BC067074	T	C	13: 113,366,154	F131S	probably damaging	Het
Ccdc158	A	G	5: 92,649,070	L469P	probably damaging	Het
Ctsm	T	C	13: 61,539,868	I59V	possibly damaging	Het
Daam2	A	G	17: 49,460,654	F970L	probably damaging	Het
Gm21903	A	T	17: 39,042,656		probably benign	Het
Gpr158	T	A	2: 21,826,999	M970K	probably damaging	Het
Hist1h2bf	G	A	13: 23,574,181		probably benign	Het
Hoxd10	T	A	2: 74,692,362	V128D	probably benign	Het
Ighv5-9	T	C	12: 113,661,947	T59A	probably benign	Het
Nlrp4c	G	A	7: 6,065,525	V142M	probably benign	Het
Olfr356	T	A	2: 36,937,209	I30N	possibly damaging	Het
Olfr504	G	T	7: 108,564,944	H284N	probably benign	Het
Piezo2	G	T	18: 63,024,435	Y223*	probably null	Het
Rhog	A	T	7: 102,240,138	V36E	probably damaging	Het
Sbno1	G	A	5: 124,381,708	T1168I	probably damaging	Het
Sin3a	T	A	9: 57,096,834	L290*	probably null	Het
Slco1c1	G	T	6: 141,532,654	A48S	probably damaging	Het
Slfn9	A	T	11: 82,981,764	S715R	possibly damaging	Het
Sox17	T	C	1: 4,492,617	E120G	probably damaging	Het

Other mutations in Npc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02347:Npc1	APN	18	12199634	missense	probably benign	0.45
IGL02523:Npc1	APN	18	12201572	missense	probably benign	0.00
IGL03018:Npc1	APN	18	12214379	missense	probably damaging	0.99
IGL03101:Npc1	APN	18	12198539	missense	probably benign	0.15
IGL03151:Npc1	APN	18	12219275	missense	probably benign	0.05
IGL03377:Npc1	APN	18	12211821	missense	probably benign
PIT4354001:Npc1	UTSW	18	12211535	missense	probably benign	0.00
R0068:Npc1	UTSW	18	12208367	missense	probably benign	0.04
R0068:Npc1	UTSW	18	12208367	missense	probably benign	0.04
R0190:Npc1	UTSW	18	12191830	missense	probably damaging	1.00
R0200:Npc1	UTSW	18	12219204	missense	probably damaging	1.00
R0485:Npc1	UTSW	18	12213446	missense	probably benign	0.00
R0699:Npc1	UTSW	18	12210575	missense	probably benign	0.00
R0730:Npc1	UTSW	18	12219325	missense	probably benign	0.00
R1302:Npc1	UTSW	18	12195085	missense	probably benign	0.00
R1442:Npc1	UTSW	18	12195049	missense	probably benign
R1463:Npc1	UTSW	18	12191830	missense	probably damaging	1.00
R1804:Npc1	UTSW	18	12223088	missense	probably damaging	1.00
R1808:Npc1	UTSW	18	12194092	missense	probably damaging	1.00
R1928:Npc1	UTSW	18	12213378	missense	possibly damaging	0.79
R2112:Npc1	UTSW	18	12213472	missense	possibly damaging	0.49
R2117:Npc1	UTSW	18	12196556	missense	probably damaging	1.00
R2157:Npc1	UTSW	18	12191809	missense	probably damaging	0.98
R2279:Npc1	UTSW	18	12197179	splice site	probably null
R2311:Npc1	UTSW	18	12202183	missense	probably benign
R2446:Npc1	UTSW	18	12214339	missense	probably benign	0.01
R4090:Npc1	UTSW	18	12198162	splice site	probably null
R4304:Npc1	UTSW	18	12210527	missense	possibly damaging	0.77
R4308:Npc1	UTSW	18	12210527	missense	possibly damaging	0.77
R4564:Npc1	UTSW	18	12191732	missense	probably damaging	1.00
R4786:Npc1	UTSW	18	12199497	missense	probably benign	0.35
R5243:Npc1	UTSW	18	12198631	intron	probably benign
R5404:Npc1	UTSW	18	12213299	missense	possibly damaging	0.79
R5823:Npc1	UTSW	18	12191789	missense	possibly damaging	0.69
R6080:Npc1	UTSW	18	12219351	missense	probably damaging	1.00
R6215:Npc1	UTSW	18	12236192	small deletion	probably benign
R6301:Npc1	UTSW	18	12197245	missense	probably benign	0.00
R6476:Npc1	UTSW	18	12201694	nonsense	probably null
R7007:Npc1	UTSW	18	12210548	missense	probably benign	0.02
R7020:Npc1	UTSW	18	12198537	missense	probably damaging	1.00
R7048:Npc1	UTSW	18	12204765	splice site	probably null
R7116:Npc1	UTSW	18	12211544	missense	probably damaging	1.00
R7153:Npc1	UTSW	18	12213291	missense	possibly damaging	0.78
R7359:Npc1	UTSW	18	12195180	missense	probably benign	0.05
R7382:Npc1	UTSW	18	12201706	missense	probably damaging	0.99
X0012:Npc1	UTSW	18	12193311	unclassified	probably null

Predicted Primers

PCR Primer
(F):5'- ACGTGTGTGACTGAGCACAG -3'
(R):5'- AGTTTCCTGTGAGCAAAGTGGG -3'

Sequencing Primer
(F):5'- GAGACGGCTCCAACACTG -3'
(R):5'- GCAAAGTGGGCTCATTGGC -3'

Posted On

2015-01-11