Incidental Mutation 'R3005:Ppp2r5a'
ID257405
Institutional Source Beutler Lab
Gene Symbol Ppp2r5a
Ensembl Gene ENSMUSG00000026626
Gene Nameprotein phosphatase 2, regulatory subunit B', alpha
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R3005 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location191351975-191403272 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 191358976 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 218 (F218Y)
Ref Sequence ENSEMBL: ENSMUSP00000070726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067976]
Predicted Effect probably damaging
Transcript: ENSMUST00000067976
AA Change: F218Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000070726
Gene: ENSMUSG00000026626
AA Change: F218Y

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Pfam:B56 56 462 3.6e-193 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191920
Predicted Effect probably benign
Transcript: ENSMUST00000191925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195605
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an alpha isoform of the regulatory subunit B56 subfamily. Alternative transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,259,959 N405K possibly damaging Het
4931406P16Rik T C 7: 34,284,784 E138G probably damaging Het
Cep162 C A 9: 87,232,060 V320L probably benign Het
Cnga1 T A 5: 72,605,107 I355F probably damaging Het
Csnk1e T C 15: 79,438,805 I15V probably benign Het
Exosc8 T C 3: 54,732,147 probably null Het
Gstm3 G T 3: 107,967,607 Q110K probably benign Het
Hace1 G A 10: 45,648,863 G242R probably damaging Het
Lcn6 T A 2: 25,677,249 probably null Het
Msh6 A G 17: 87,988,285 E1088G probably benign Het
Nlrp4c G A 7: 6,065,525 V142M probably benign Het
Nup50 G A 15: 84,929,460 probably null Het
Olfr577 C T 7: 102,973,258 V245I possibly damaging Het
Ptov1 T C 7: 44,864,462 N52S probably damaging Het
Rif1 G A 2: 52,082,764 A303T probably damaging Het
Ror1 T A 4: 100,441,764 V778E probably damaging Het
Tcaf3 A T 6: 42,594,044 L258H probably damaging Het
Utp20 C A 10: 88,777,455 K1321N probably damaging Het
Vmn2r54 T A 7: 12,615,294 Q787L probably benign Het
Other mutations in Ppp2r5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03297:Ppp2r5a APN 1 191354762 missense probably benign 0.28
R1640:Ppp2r5a UTSW 1 191353929 missense probably damaging 0.99
R4810:Ppp2r5a UTSW 1 191356392 unclassified probably benign
R5730:Ppp2r5a UTSW 1 191372535 missense probably benign 0.04
R5769:Ppp2r5a UTSW 1 191372666 missense probably benign 0.02
R5783:Ppp2r5a UTSW 1 191354640 missense probably damaging 0.98
R6215:Ppp2r5a UTSW 1 191362250 missense probably benign 0.02
R7311:Ppp2r5a UTSW 1 191357801 missense probably damaging 1.00
R7485:Ppp2r5a UTSW 1 191396335 missense probably benign 0.07
R7545:Ppp2r5a UTSW 1 191372609 missense probably benign 0.00
V5622:Ppp2r5a UTSW 1 191358992 missense probably damaging 1.00
V5622:Ppp2r5a UTSW 1 191359001 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TTCTACGTTAGGCTGCCAC -3'
(R):5'- AACTTTCGAACAGCCTGGCC -3'

Sequencing Primer
(F):5'- TGCCACCGTGTGAGAAC -3'
(R):5'- TTCAAGGCCAGCATGGGTTAC -3'
Posted On2015-01-11