Incidental Mutation 'R3005:Lcn6'
ID257406
Institutional Source Beutler Lab
Gene Symbol Lcn6
Ensembl Gene ENSMUSG00000045684
Gene Namelipocalin 6
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R3005 (G1)
Quality Score213
Status Not validated
Chromosome2
Chromosomal Location25676786-25681608 bp(+) (GRCm38)
Type of Mutationintron (28 bp from exon)
DNA Base Change (assembly) T to A at 25677249 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059693] [ENSMUST00000114197] [ENSMUST00000114199]
Predicted Effect probably benign
Transcript: ENSMUST00000059693
SMART Domains Protein: ENSMUSP00000055660
Gene: ENSMUSG00000045684

DomainStartEndE-ValueType
Pfam:Lipocalin 7 106 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114197
SMART Domains Protein: ENSMUSP00000109835
Gene: ENSMUSG00000045684

DomainStartEndE-ValueType
Pfam:Lipocalin 7 106 4.8e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114199
SMART Domains Protein: ENSMUSP00000109837
Gene: ENSMUSG00000045684

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Lipocalin 33 172 2.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139441
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice with loss of expression in the testes show premature acrosome reaction and elevated intracellular calcium levels in sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,259,959 N405K possibly damaging Het
4931406P16Rik T C 7: 34,284,784 E138G probably damaging Het
Cep162 C A 9: 87,232,060 V320L probably benign Het
Cnga1 T A 5: 72,605,107 I355F probably damaging Het
Csnk1e T C 15: 79,438,805 I15V probably benign Het
Exosc8 T C 3: 54,732,147 probably null Het
Gstm3 G T 3: 107,967,607 Q110K probably benign Het
Hace1 G A 10: 45,648,863 G242R probably damaging Het
Msh6 A G 17: 87,988,285 E1088G probably benign Het
Nlrp4c G A 7: 6,065,525 V142M probably benign Het
Nup50 G A 15: 84,929,460 probably null Het
Olfr577 C T 7: 102,973,258 V245I possibly damaging Het
Ppp2r5a A T 1: 191,358,976 F218Y probably damaging Het
Ptov1 T C 7: 44,864,462 N52S probably damaging Het
Rif1 G A 2: 52,082,764 A303T probably damaging Het
Ror1 T A 4: 100,441,764 V778E probably damaging Het
Tcaf3 A T 6: 42,594,044 L258H probably damaging Het
Utp20 C A 10: 88,777,455 K1321N probably damaging Het
Vmn2r54 T A 7: 12,615,294 Q787L probably benign Het
Other mutations in Lcn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Lcn6 APN 2 25680780 missense probably benign 0.29
R0747:Lcn6 UTSW 2 25677172 missense probably damaging 1.00
R1387:Lcn6 UTSW 2 25677137 missense possibly damaging 0.86
R1500:Lcn6 UTSW 2 25677119 missense probably benign 0.00
R1654:Lcn6 UTSW 2 25680775 unclassified probably null
R4821:Lcn6 UTSW 2 25680810 missense probably damaging 1.00
R4972:Lcn6 UTSW 2 25680067 missense probably damaging 1.00
R5011:Lcn6 UTSW 2 25677070 splice site probably null
R5013:Lcn6 UTSW 2 25677070 splice site probably null
R7779:Lcn6 UTSW 2 25680793 missense probably benign
R8034:Lcn6 UTSW 2 25676871 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTAGGTGTCTTAGCTGATGC -3'
(R):5'- ATCCGGTAAGAGGAAGTGCC -3'

Sequencing Primer
(F):5'- GATGCTTCCTCTAGCTCCTCGG -3'
(R):5'- ATACCACTCTCTCTAGGGAGTCAGG -3'
Posted On2015-01-11