Incidental Mutation 'R3005:Gstm3'
ID257409
Institutional Source Beutler Lab
Gene Symbol Gstm3
Ensembl Gene ENSMUSG00000004038
Gene Nameglutathione S-transferase, mu 3
SynonymsmGSTM5, Fsc2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R3005 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location107963696-107969283 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 107967607 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 110 (Q110K)
Ref Sequence ENSEMBL: ENSMUSP00000004136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004136]
Predicted Effect probably benign
Transcript: ENSMUST00000004136
AA Change: Q110K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000004136
Gene: ENSMUSG00000004038
AA Change: Q110K

DomainStartEndE-ValueType
Pfam:GST_N 3 82 6.6e-22 PFAM
Pfam:GST_C_3 41 190 7.7e-11 PFAM
Pfam:GST_C 104 191 1.6e-17 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,259,959 N405K possibly damaging Het
4931406P16Rik T C 7: 34,284,784 E138G probably damaging Het
Cep162 C A 9: 87,232,060 V320L probably benign Het
Cnga1 T A 5: 72,605,107 I355F probably damaging Het
Csnk1e T C 15: 79,438,805 I15V probably benign Het
Exosc8 T C 3: 54,732,147 probably null Het
Hace1 G A 10: 45,648,863 G242R probably damaging Het
Lcn6 T A 2: 25,677,249 probably null Het
Msh6 A G 17: 87,988,285 E1088G probably benign Het
Nlrp4c G A 7: 6,065,525 V142M probably benign Het
Nup50 G A 15: 84,929,460 probably null Het
Olfr577 C T 7: 102,973,258 V245I possibly damaging Het
Ppp2r5a A T 1: 191,358,976 F218Y probably damaging Het
Ptov1 T C 7: 44,864,462 N52S probably damaging Het
Rif1 G A 2: 52,082,764 A303T probably damaging Het
Ror1 T A 4: 100,441,764 V778E probably damaging Het
Tcaf3 A T 6: 42,594,044 L258H probably damaging Het
Utp20 C A 10: 88,777,455 K1321N probably damaging Het
Vmn2r54 T A 7: 12,615,294 Q787L probably benign Het
Other mutations in Gstm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01585:Gstm3 APN 3 107966158 missense probably benign 0.42
IGL01637:Gstm3 APN 3 107967633 missense probably damaging 1.00
IGL01937:Gstm3 APN 3 107967657 missense probably damaging 0.98
IGL01945:Gstm3 APN 3 107967657 missense probably damaging 0.98
IGL02307:Gstm3 APN 3 107967613 missense probably damaging 0.98
IGL02820:Gstm3 APN 3 107968758 splice site probably benign
IGL03038:Gstm3 APN 3 107966169 missense possibly damaging 0.75
IGL03108:Gstm3 APN 3 107967764 critical splice donor site probably null
IGL03271:Gstm3 APN 3 107966197 missense possibly damaging 0.47
IGL03097:Gstm3 UTSW 3 107968801 missense probably benign
R0009:Gstm3 UTSW 3 107967840 missense probably damaging 1.00
R0883:Gstm3 UTSW 3 107966270 splice site probably benign
R1623:Gstm3 UTSW 3 107967835 missense possibly damaging 0.80
R2108:Gstm3 UTSW 3 107966134 missense probably damaging 0.99
R3802:Gstm3 UTSW 3 107964235 missense probably benign 0.03
R3803:Gstm3 UTSW 3 107964235 missense probably benign 0.03
R3804:Gstm3 UTSW 3 107964235 missense probably benign 0.03
R4604:Gstm3 UTSW 3 107968197 missense possibly damaging 0.73
R4837:Gstm3 UTSW 3 107964215 missense probably benign
R6593:Gstm3 UTSW 3 107968195 missense probably benign 0.01
R6963:Gstm3 UTSW 3 107967624 missense probably benign 0.01
R7790:Gstm3 UTSW 3 107969239 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CGAAGGTCGTTCTGTTGGTAAGATC -3'
(R):5'- TTGATGGGTCACACAAGGTCAC -3'

Sequencing Primer
(F):5'- TCTGTTGGTAAGATCCGAAAGC -3'
(R):5'- AGAGCAATGCCATCCTGCG -3'
Posted On2015-01-11