Mutagenetix > Incidental Mutation

Incidental Mutation 'R3005:4931406P16Rik'

257417

Institutional Source

Beutler Lab

Gene Symbol

4931406P16Rik

Ensembl Gene

ENSMUSG00000066571

Gene Name

RIKEN cDNA 4931406P16 gene

Synonyms

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3005 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34236707-34313551 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34284784 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 138 (E138G)

Ref Sequence

ENSEMBL: ENSMUSP00000103709 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085592] [ENSMUST00000108074] [ENSMUST00000206399]

AlphaFold

Q8C5X1

Predicted Effect

probably damaging
Transcript: ENSMUST00000085592
AA Change: E138G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000082730
Gene: ENSMUSG00000066571
AA Change: E138G

Domain	Start	End	E-Value	Type
low complexity region	40	57	N/A	INTRINSIC
Pfam:DUF4745	59	187	1.3e-57	PFAM
low complexity region	319	332	N/A	INTRINSIC
low complexity region	592	602	N/A	INTRINSIC
low complexity region	677	696	N/A	INTRINSIC
low complexity region	699	729	N/A	INTRINSIC
low complexity region	771	786	N/A	INTRINSIC
low complexity region	856	868	N/A	INTRINSIC
low complexity region	890	913	N/A	INTRINSIC
low complexity region	940	951	N/A	INTRINSIC
low complexity region	1026	1049	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108074
AA Change: E138G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103709
Gene: ENSMUSG00000066571
AA Change: E138G

Domain	Start	End	E-Value	Type
low complexity region	40	57	N/A	INTRINSIC
low complexity region	319	332	N/A	INTRINSIC
low complexity region	592	602	N/A	INTRINSIC
low complexity region	677	696	N/A	INTRINSIC
low complexity region	699	729	N/A	INTRINSIC
low complexity region	771	786	N/A	INTRINSIC
low complexity region	856	868	N/A	INTRINSIC
low complexity region	890	913	N/A	INTRINSIC
low complexity region	940	951	N/A	INTRINSIC
low complexity region	1026	1049	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132975

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146025

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206018

Predicted Effect

probably benign
Transcript: ENSMUST00000206399

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	A	18: 38,259,959	N405K	possibly damaging	Het
Cep162	C	A	9: 87,232,060	V320L	probably benign	Het
Cnga1	T	A	5: 72,605,107	I355F	probably damaging	Het
Csnk1e	T	C	15: 79,438,805	I15V	probably benign	Het
Exosc8	T	C	3: 54,732,147		probably null	Het
Gstm3	G	T	3: 107,967,607	Q110K	probably benign	Het
Hace1	G	A	10: 45,648,863	G242R	probably damaging	Het
Lcn6	T	A	2: 25,677,249		probably null	Het
Msh6	A	G	17: 87,988,285	E1088G	probably benign	Het
Nlrp4c	G	A	7: 6,065,525	V142M	probably benign	Het
Nup50	G	A	15: 84,929,460		probably null	Het
Olfr577	C	T	7: 102,973,258	V245I	possibly damaging	Het
Ppp2r5a	A	T	1: 191,358,976	F218Y	probably damaging	Het
Ptov1	T	C	7: 44,864,462	N52S	probably damaging	Het
Rif1	G	A	2: 52,082,764	A303T	probably damaging	Het
Ror1	T	A	4: 100,441,764	V778E	probably damaging	Het
Tcaf3	A	T	6: 42,594,044	L258H	probably damaging	Het
Utp20	C	A	10: 88,777,455	K1321N	probably damaging	Het
Vmn2r54	T	A	7: 12,615,294	Q787L	probably benign	Het

Other mutations in 4931406P16Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:4931406P16Rik	APN	7	34245987	splice site	probably benign
IGL00160:4931406P16Rik	APN	7	34239006	missense	possibly damaging	0.88
IGL00691:4931406P16Rik	APN	7	34245485	missense	probably damaging	1.00
IGL01312:4931406P16Rik	APN	7	34256508	missense	probably benign	0.19
IGL01954:4931406P16Rik	APN	7	34245035	missense	probably damaging	1.00
IGL02016:4931406P16Rik	APN	7	34239101	missense	possibly damaging	0.74
IGL02390:4931406P16Rik	APN	7	34248218	missense	probably damaging	1.00
IGL02407:4931406P16Rik	APN	7	34256484	missense	probably damaging	0.99
IGL02677:4931406P16Rik	APN	7	34242409	splice site	probably benign
IGL02929:4931406P16Rik	APN	7	34245082	missense	possibly damaging	0.46
IGL03285:4931406P16Rik	APN	7	34284991	missense	possibly damaging	0.81
I1329:4931406P16Rik	UTSW	7	34245194	missense	probably benign	0.00
R0004:4931406P16Rik	UTSW	7	34256428	missense	probably damaging	0.99
R0100:4931406P16Rik	UTSW	7	34254011	missense	possibly damaging	0.95
R0100:4931406P16Rik	UTSW	7	34254011	missense	possibly damaging	0.95
R0135:4931406P16Rik	UTSW	7	34245957	missense	probably damaging	1.00
R0137:4931406P16Rik	UTSW	7	34239219	missense	probably damaging	1.00
R0556:4931406P16Rik	UTSW	7	34239797	missense	probably damaging	0.99
R0687:4931406P16Rik	UTSW	7	34245418	missense	possibly damaging	0.95
R0928:4931406P16Rik	UTSW	7	34248246	splice site	probably null
R1719:4931406P16Rik	UTSW	7	34248206	missense	probably damaging	0.98
R1908:4931406P16Rik	UTSW	7	34258036	missense	probably benign	0.14
R1909:4931406P16Rik	UTSW	7	34258036	missense	probably benign	0.14
R1976:4931406P16Rik	UTSW	7	34257380	missense	probably damaging	0.99
R2496:4931406P16Rik	UTSW	7	34256491	missense	possibly damaging	0.93
R4666:4931406P16Rik	UTSW	7	34284773	missense	probably damaging	0.98
R4832:4931406P16Rik	UTSW	7	34238908	utr 3 prime	probably benign
R4870:4931406P16Rik	UTSW	7	34284887	missense	possibly damaging	0.83
R4989:4931406P16Rik	UTSW	7	34245800	missense	probably damaging	1.00
R5033:4931406P16Rik	UTSW	7	34245812	missense	probably benign
R5308:4931406P16Rik	UTSW	7	34245755	nonsense	probably null
R5366:4931406P16Rik	UTSW	7	34242288	missense	possibly damaging	0.74
R5386:4931406P16Rik	UTSW	7	34242388	missense	probably damaging	0.99
R5688:4931406P16Rik	UTSW	7	34253991	missense	possibly damaging	0.74
R5688:4931406P16Rik	UTSW	7	34284709	missense	probably damaging	0.99
R5714:4931406P16Rik	UTSW	7	34240516	nonsense	probably null
R5733:4931406P16Rik	UTSW	7	34245080	missense	probably damaging	0.99
R5772:4931406P16Rik	UTSW	7	34253988	missense	probably damaging	0.97
R6059:4931406P16Rik	UTSW	7	34245463	missense	possibly damaging	0.90
R6211:4931406P16Rik	UTSW	7	34239004	missense	possibly damaging	0.95
R6276:4931406P16Rik	UTSW	7	34242377	nonsense	probably null
R6477:4931406P16Rik	UTSW	7	34257630	critical splice donor site	probably null
R6757:4931406P16Rik	UTSW	7	34239077	missense	possibly damaging	0.89
R6912:4931406P16Rik	UTSW	7	34245668	missense	probably benign
R7156:4931406P16Rik	UTSW	7	34245708	missense	possibly damaging	0.80
R7317:4931406P16Rik	UTSW	7	34263647	missense	probably benign
R7431:4931406P16Rik	UTSW	7	34284794	missense	possibly damaging	0.73
R7452:4931406P16Rik	UTSW	7	34245671	missense	probably benign
R7996:4931406P16Rik	UTSW	7	34263599	missense	possibly damaging	0.77
R8348:4931406P16Rik	UTSW	7	34285144	missense	probably damaging	1.00
R8448:4931406P16Rik	UTSW	7	34285144	missense	probably damaging	1.00
R8989:4931406P16Rik	UTSW	7	34257444	missense	probably damaging	0.99
R9010:4931406P16Rik	UTSW	7	34239066	missense	probably benign	0.01
R9095:4931406P16Rik	UTSW	7	34257345	critical splice donor site	probably null
R9505:4931406P16Rik	UTSW	7	34284946	missense	probably damaging	1.00
R9530:4931406P16Rik	UTSW	7	34263644	missense	probably benign	0.01
R9612:4931406P16Rik	UTSW	7	34248231	missense	probably damaging	1.00
RF019:4931406P16Rik	UTSW	7	34240549	missense	probably damaging	0.98
X0021:4931406P16Rik	UTSW	7	34245363	missense	possibly damaging	0.94
Z1177:4931406P16Rik	UTSW	7	34284755	missense	probably damaging	0.96
Z1186:4931406P16Rik	UTSW	7	34239108	missense	probably benign
Z1186:4931406P16Rik	UTSW	7	34239158	missense	probably benign	0.03
Z1186:4931406P16Rik	UTSW	7	34245760	missense	probably benign
Z1191:4931406P16Rik	UTSW	7	34239108	missense	probably benign
Z1191:4931406P16Rik	UTSW	7	34239158	missense	probably benign	0.03
Z1191:4931406P16Rik	UTSW	7	34245760	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCAGAACTTGGCAGGCAC -3'
(R):5'- TCTCTAAGTACCTGGATGCCC -3'

Sequencing Primer
(F):5'- TGGCAGGCACCAAACTTTTTAC -3'
(R):5'- TAAGTACCTGGATGCCCTCAATG -3'

Posted On

2015-01-11