Incidental Mutation 'R3005:4931406P16Rik'
ID 257417
Institutional Source Beutler Lab
Gene Symbol 4931406P16Rik
Ensembl Gene ENSMUSG00000066571
Gene Name RIKEN cDNA 4931406P16 gene
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3005 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 34236707-34313551 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34284784 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 138 (E138G)
Ref Sequence ENSEMBL: ENSMUSP00000103709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085592] [ENSMUST00000108074] [ENSMUST00000206399]
AlphaFold Q8C5X1
Predicted Effect probably damaging
Transcript: ENSMUST00000085592
AA Change: E138G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082730
Gene: ENSMUSG00000066571
AA Change: E138G

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Pfam:DUF4745 59 187 1.3e-57 PFAM
low complexity region 319 332 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
low complexity region 677 696 N/A INTRINSIC
low complexity region 699 729 N/A INTRINSIC
low complexity region 771 786 N/A INTRINSIC
low complexity region 856 868 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 940 951 N/A INTRINSIC
low complexity region 1026 1049 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108074
AA Change: E138G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103709
Gene: ENSMUSG00000066571
AA Change: E138G

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
low complexity region 677 696 N/A INTRINSIC
low complexity region 699 729 N/A INTRINSIC
low complexity region 771 786 N/A INTRINSIC
low complexity region 856 868 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 940 951 N/A INTRINSIC
low complexity region 1026 1049 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132975
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206018
Predicted Effect probably benign
Transcript: ENSMUST00000206399
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,259,959 N405K possibly damaging Het
Cep162 C A 9: 87,232,060 V320L probably benign Het
Cnga1 T A 5: 72,605,107 I355F probably damaging Het
Csnk1e T C 15: 79,438,805 I15V probably benign Het
Exosc8 T C 3: 54,732,147 probably null Het
Gstm3 G T 3: 107,967,607 Q110K probably benign Het
Hace1 G A 10: 45,648,863 G242R probably damaging Het
Lcn6 T A 2: 25,677,249 probably null Het
Msh6 A G 17: 87,988,285 E1088G probably benign Het
Nlrp4c G A 7: 6,065,525 V142M probably benign Het
Nup50 G A 15: 84,929,460 probably null Het
Olfr577 C T 7: 102,973,258 V245I possibly damaging Het
Ppp2r5a A T 1: 191,358,976 F218Y probably damaging Het
Ptov1 T C 7: 44,864,462 N52S probably damaging Het
Rif1 G A 2: 52,082,764 A303T probably damaging Het
Ror1 T A 4: 100,441,764 V778E probably damaging Het
Tcaf3 A T 6: 42,594,044 L258H probably damaging Het
Utp20 C A 10: 88,777,455 K1321N probably damaging Het
Vmn2r54 T A 7: 12,615,294 Q787L probably benign Het
Other mutations in 4931406P16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:4931406P16Rik APN 7 34245987 splice site probably benign
IGL00160:4931406P16Rik APN 7 34239006 missense possibly damaging 0.88
IGL00691:4931406P16Rik APN 7 34245485 missense probably damaging 1.00
IGL01312:4931406P16Rik APN 7 34256508 missense probably benign 0.19
IGL01954:4931406P16Rik APN 7 34245035 missense probably damaging 1.00
IGL02016:4931406P16Rik APN 7 34239101 missense possibly damaging 0.74
IGL02390:4931406P16Rik APN 7 34248218 missense probably damaging 1.00
IGL02407:4931406P16Rik APN 7 34256484 missense probably damaging 0.99
IGL02677:4931406P16Rik APN 7 34242409 splice site probably benign
IGL02929:4931406P16Rik APN 7 34245082 missense possibly damaging 0.46
IGL03285:4931406P16Rik APN 7 34284991 missense possibly damaging 0.81
I1329:4931406P16Rik UTSW 7 34245194 missense probably benign 0.00
R0004:4931406P16Rik UTSW 7 34256428 missense probably damaging 0.99
R0100:4931406P16Rik UTSW 7 34254011 missense possibly damaging 0.95
R0100:4931406P16Rik UTSW 7 34254011 missense possibly damaging 0.95
R0135:4931406P16Rik UTSW 7 34245957 missense probably damaging 1.00
R0137:4931406P16Rik UTSW 7 34239219 missense probably damaging 1.00
R0556:4931406P16Rik UTSW 7 34239797 missense probably damaging 0.99
R0687:4931406P16Rik UTSW 7 34245418 missense possibly damaging 0.95
R0928:4931406P16Rik UTSW 7 34248246 splice site probably null
R1719:4931406P16Rik UTSW 7 34248206 missense probably damaging 0.98
R1908:4931406P16Rik UTSW 7 34258036 missense probably benign 0.14
R1909:4931406P16Rik UTSW 7 34258036 missense probably benign 0.14
R1976:4931406P16Rik UTSW 7 34257380 missense probably damaging 0.99
R2496:4931406P16Rik UTSW 7 34256491 missense possibly damaging 0.93
R4666:4931406P16Rik UTSW 7 34284773 missense probably damaging 0.98
R4832:4931406P16Rik UTSW 7 34238908 utr 3 prime probably benign
R4870:4931406P16Rik UTSW 7 34284887 missense possibly damaging 0.83
R4989:4931406P16Rik UTSW 7 34245800 missense probably damaging 1.00
R5033:4931406P16Rik UTSW 7 34245812 missense probably benign
R5308:4931406P16Rik UTSW 7 34245755 nonsense probably null
R5366:4931406P16Rik UTSW 7 34242288 missense possibly damaging 0.74
R5386:4931406P16Rik UTSW 7 34242388 missense probably damaging 0.99
R5688:4931406P16Rik UTSW 7 34253991 missense possibly damaging 0.74
R5688:4931406P16Rik UTSW 7 34284709 missense probably damaging 0.99
R5714:4931406P16Rik UTSW 7 34240516 nonsense probably null
R5733:4931406P16Rik UTSW 7 34245080 missense probably damaging 0.99
R5772:4931406P16Rik UTSW 7 34253988 missense probably damaging 0.97
R6059:4931406P16Rik UTSW 7 34245463 missense possibly damaging 0.90
R6211:4931406P16Rik UTSW 7 34239004 missense possibly damaging 0.95
R6276:4931406P16Rik UTSW 7 34242377 nonsense probably null
R6477:4931406P16Rik UTSW 7 34257630 critical splice donor site probably null
R6757:4931406P16Rik UTSW 7 34239077 missense possibly damaging 0.89
R6912:4931406P16Rik UTSW 7 34245668 missense probably benign
R7156:4931406P16Rik UTSW 7 34245708 missense possibly damaging 0.80
R7317:4931406P16Rik UTSW 7 34263647 missense probably benign
R7431:4931406P16Rik UTSW 7 34284794 missense possibly damaging 0.73
R7452:4931406P16Rik UTSW 7 34245671 missense probably benign
R7996:4931406P16Rik UTSW 7 34263599 missense possibly damaging 0.77
R8348:4931406P16Rik UTSW 7 34285144 missense probably damaging 1.00
R8448:4931406P16Rik UTSW 7 34285144 missense probably damaging 1.00
R8989:4931406P16Rik UTSW 7 34257444 missense probably damaging 0.99
R9010:4931406P16Rik UTSW 7 34239066 missense probably benign 0.01
R9095:4931406P16Rik UTSW 7 34257345 critical splice donor site probably null
R9505:4931406P16Rik UTSW 7 34284946 missense probably damaging 1.00
R9530:4931406P16Rik UTSW 7 34263644 missense probably benign 0.01
R9612:4931406P16Rik UTSW 7 34248231 missense probably damaging 1.00
RF019:4931406P16Rik UTSW 7 34240549 missense probably damaging 0.98
X0021:4931406P16Rik UTSW 7 34245363 missense possibly damaging 0.94
Z1177:4931406P16Rik UTSW 7 34284755 missense probably damaging 0.96
Z1186:4931406P16Rik UTSW 7 34239108 missense probably benign
Z1186:4931406P16Rik UTSW 7 34239158 missense probably benign 0.03
Z1186:4931406P16Rik UTSW 7 34245760 missense probably benign
Z1191:4931406P16Rik UTSW 7 34239108 missense probably benign
Z1191:4931406P16Rik UTSW 7 34239158 missense probably benign 0.03
Z1191:4931406P16Rik UTSW 7 34245760 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCAGAACTTGGCAGGCAC -3'
(R):5'- TCTCTAAGTACCTGGATGCCC -3'

Sequencing Primer
(F):5'- TGGCAGGCACCAAACTTTTTAC -3'
(R):5'- TAAGTACCTGGATGCCCTCAATG -3'
Posted On 2015-01-11