Mutagenetix > Incidental Mutation

Incidental Mutation 'R3005:Garre1'

257417

Institutional Source

Beutler Lab

Gene Symbol

Garre1

Ensembl Gene

ENSMUSG00000066571

Gene Name

granule associated Rac and RHOG effector 1

Synonyms

4931406P16Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3005 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

33936132-34012976 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 33984209 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 138 (E138G)

Ref Sequence

ENSEMBL: ENSMUSP00000103709 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085592] [ENSMUST00000108074] [ENSMUST00000206399]

AlphaFold

Q8C5X1

Predicted Effect

probably damaging
Transcript: ENSMUST00000085592
AA Change: E138G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000082730
Gene: ENSMUSG00000066571
AA Change: E138G

Domain	Start	End	E-Value	Type
low complexity region	40	57	N/A	INTRINSIC
Pfam:DUF4745	59	187	1.3e-57	PFAM
low complexity region	319	332	N/A	INTRINSIC
low complexity region	592	602	N/A	INTRINSIC
low complexity region	677	696	N/A	INTRINSIC
low complexity region	699	729	N/A	INTRINSIC
low complexity region	771	786	N/A	INTRINSIC
low complexity region	856	868	N/A	INTRINSIC
low complexity region	890	913	N/A	INTRINSIC
low complexity region	940	951	N/A	INTRINSIC
low complexity region	1026	1049	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108074
AA Change: E138G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103709
Gene: ENSMUSG00000066571
AA Change: E138G

Domain	Start	End	E-Value	Type
low complexity region	40	57	N/A	INTRINSIC
low complexity region	319	332	N/A	INTRINSIC
low complexity region	592	602	N/A	INTRINSIC
low complexity region	677	696	N/A	INTRINSIC
low complexity region	699	729	N/A	INTRINSIC
low complexity region	771	786	N/A	INTRINSIC
low complexity region	856	868	N/A	INTRINSIC
low complexity region	890	913	N/A	INTRINSIC
low complexity region	940	951	N/A	INTRINSIC
low complexity region	1026	1049	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132975

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146025

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206018

Predicted Effect

probably benign
Transcript: ENSMUST00000206399

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cep162	C	A	9: 87,114,113 (GRCm39)	V320L	probably benign	Het
Cnga1	T	A	5: 72,762,450 (GRCm39)	I355F	probably damaging	Het
Csnk1e	T	C	15: 79,323,005 (GRCm39)	I15V	probably benign	Het
Dele1	T	A	18: 38,393,012 (GRCm39)	N405K	possibly damaging	Het
Exosc8	T	C	3: 54,639,568 (GRCm39)		probably null	Het
Gstm3	G	T	3: 107,874,923 (GRCm39)	Q110K	probably benign	Het
Hace1	G	A	10: 45,524,959 (GRCm39)	G242R	probably damaging	Het
Lcn6	T	A	2: 25,567,261 (GRCm39)		probably null	Het
Msh6	A	G	17: 88,295,713 (GRCm39)	E1088G	probably benign	Het
Nlrp4c	G	A	7: 6,068,524 (GRCm39)	V142M	probably benign	Het
Nup50	G	A	15: 84,813,661 (GRCm39)		probably null	Het
Or51g2	C	T	7: 102,622,465 (GRCm39)	V245I	possibly damaging	Het
Ppp2r5a	A	T	1: 191,091,173 (GRCm39)	F218Y	probably damaging	Het
Ptov1	T	C	7: 44,513,886 (GRCm39)	N52S	probably damaging	Het
Rif1	G	A	2: 51,972,776 (GRCm39)	A303T	probably damaging	Het
Ror1	T	A	4: 100,298,961 (GRCm39)	V778E	probably damaging	Het
Tcaf3	A	T	6: 42,570,978 (GRCm39)	L258H	probably damaging	Het
Utp20	C	A	10: 88,613,317 (GRCm39)	K1321N	probably damaging	Het
Vmn2r54	T	A	7: 12,349,221 (GRCm39)	Q787L	probably benign	Het

Other mutations in Garre1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Garre1	APN	7	33,945,412 (GRCm39)	splice site	probably benign
IGL00160:Garre1	APN	7	33,938,431 (GRCm39)	missense	possibly damaging	0.88
IGL00691:Garre1	APN	7	33,944,910 (GRCm39)	missense	probably damaging	1.00
IGL01312:Garre1	APN	7	33,955,933 (GRCm39)	missense	probably benign	0.19
IGL01954:Garre1	APN	7	33,944,460 (GRCm39)	missense	probably damaging	1.00
IGL02016:Garre1	APN	7	33,938,526 (GRCm39)	missense	possibly damaging	0.74
IGL02390:Garre1	APN	7	33,947,643 (GRCm39)	missense	probably damaging	1.00
IGL02407:Garre1	APN	7	33,955,909 (GRCm39)	missense	probably damaging	0.99
IGL02677:Garre1	APN	7	33,941,834 (GRCm39)	splice site	probably benign
IGL02929:Garre1	APN	7	33,944,507 (GRCm39)	missense	possibly damaging	0.46
IGL03285:Garre1	APN	7	33,984,416 (GRCm39)	missense	possibly damaging	0.81
I1329:Garre1	UTSW	7	33,944,619 (GRCm39)	missense	probably benign	0.00
R0004:Garre1	UTSW	7	33,955,853 (GRCm39)	missense	probably damaging	0.99
R0100:Garre1	UTSW	7	33,953,436 (GRCm39)	missense	possibly damaging	0.95
R0100:Garre1	UTSW	7	33,953,436 (GRCm39)	missense	possibly damaging	0.95
R0135:Garre1	UTSW	7	33,945,382 (GRCm39)	missense	probably damaging	1.00
R0137:Garre1	UTSW	7	33,938,644 (GRCm39)	missense	probably damaging	1.00
R0556:Garre1	UTSW	7	33,939,222 (GRCm39)	missense	probably damaging	0.99
R0687:Garre1	UTSW	7	33,944,843 (GRCm39)	missense	possibly damaging	0.95
R0928:Garre1	UTSW	7	33,947,671 (GRCm39)	splice site	probably null
R1719:Garre1	UTSW	7	33,947,631 (GRCm39)	missense	probably damaging	0.98
R1908:Garre1	UTSW	7	33,957,461 (GRCm39)	missense	probably benign	0.14
R1909:Garre1	UTSW	7	33,957,461 (GRCm39)	missense	probably benign	0.14
R1976:Garre1	UTSW	7	33,956,805 (GRCm39)	missense	probably damaging	0.99
R2496:Garre1	UTSW	7	33,955,916 (GRCm39)	missense	possibly damaging	0.93
R4666:Garre1	UTSW	7	33,984,198 (GRCm39)	missense	probably damaging	0.98
R4832:Garre1	UTSW	7	33,938,333 (GRCm39)	utr 3 prime	probably benign
R4870:Garre1	UTSW	7	33,984,312 (GRCm39)	missense	possibly damaging	0.83
R4989:Garre1	UTSW	7	33,945,225 (GRCm39)	missense	probably damaging	1.00
R5033:Garre1	UTSW	7	33,945,237 (GRCm39)	missense	probably benign
R5308:Garre1	UTSW	7	33,945,180 (GRCm39)	nonsense	probably null
R5366:Garre1	UTSW	7	33,941,713 (GRCm39)	missense	possibly damaging	0.74
R5386:Garre1	UTSW	7	33,941,813 (GRCm39)	missense	probably damaging	0.99
R5688:Garre1	UTSW	7	33,953,416 (GRCm39)	missense	possibly damaging	0.74
R5688:Garre1	UTSW	7	33,984,134 (GRCm39)	missense	probably damaging	0.99
R5714:Garre1	UTSW	7	33,939,941 (GRCm39)	nonsense	probably null
R5733:Garre1	UTSW	7	33,944,505 (GRCm39)	missense	probably damaging	0.99
R5772:Garre1	UTSW	7	33,953,413 (GRCm39)	missense	probably damaging	0.97
R6059:Garre1	UTSW	7	33,944,888 (GRCm39)	missense	possibly damaging	0.90
R6211:Garre1	UTSW	7	33,938,429 (GRCm39)	missense	possibly damaging	0.95
R6276:Garre1	UTSW	7	33,941,802 (GRCm39)	nonsense	probably null
R6477:Garre1	UTSW	7	33,957,055 (GRCm39)	critical splice donor site	probably null
R6757:Garre1	UTSW	7	33,938,502 (GRCm39)	missense	possibly damaging	0.89
R6912:Garre1	UTSW	7	33,945,093 (GRCm39)	missense	probably benign
R7156:Garre1	UTSW	7	33,945,133 (GRCm39)	missense	possibly damaging	0.80
R7317:Garre1	UTSW	7	33,963,072 (GRCm39)	missense	probably benign
R7431:Garre1	UTSW	7	33,984,219 (GRCm39)	missense	possibly damaging	0.73
R7452:Garre1	UTSW	7	33,945,096 (GRCm39)	missense	probably benign
R7996:Garre1	UTSW	7	33,963,024 (GRCm39)	missense	possibly damaging	0.77
R8348:Garre1	UTSW	7	33,984,569 (GRCm39)	missense	probably damaging	1.00
R8448:Garre1	UTSW	7	33,984,569 (GRCm39)	missense	probably damaging	1.00
R8989:Garre1	UTSW	7	33,956,869 (GRCm39)	missense	probably damaging	0.99
R9010:Garre1	UTSW	7	33,938,491 (GRCm39)	missense	probably benign	0.01
R9095:Garre1	UTSW	7	33,956,770 (GRCm39)	critical splice donor site	probably null
R9505:Garre1	UTSW	7	33,984,371 (GRCm39)	missense	probably damaging	1.00
R9530:Garre1	UTSW	7	33,963,069 (GRCm39)	missense	probably benign	0.01
R9612:Garre1	UTSW	7	33,947,656 (GRCm39)	missense	probably damaging	1.00
RF019:Garre1	UTSW	7	33,939,974 (GRCm39)	missense	probably damaging	0.98
X0021:Garre1	UTSW	7	33,944,788 (GRCm39)	missense	possibly damaging	0.94
Z1177:Garre1	UTSW	7	33,984,180 (GRCm39)	missense	probably damaging	0.96
Z1186:Garre1	UTSW	7	33,945,185 (GRCm39)	missense	probably benign
Z1186:Garre1	UTSW	7	33,938,583 (GRCm39)	missense	probably benign	0.03
Z1186:Garre1	UTSW	7	33,938,533 (GRCm39)	missense	probably benign
Z1191:Garre1	UTSW	7	33,945,185 (GRCm39)	missense	probably benign
Z1191:Garre1	UTSW	7	33,938,583 (GRCm39)	missense	probably benign	0.03
Z1191:Garre1	UTSW	7	33,938,533 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCAGAACTTGGCAGGCAC -3'
(R):5'- TCTCTAAGTACCTGGATGCCC -3'

Sequencing Primer
(F):5'- TGGCAGGCACCAAACTTTTTAC -3'
(R):5'- TAAGTACCTGGATGCCCTCAATG -3'

Posted On

2015-01-11