Incidental Mutation 'R3005:Ptov1'
ID257418
Institutional Source Beutler Lab
Gene Symbol Ptov1
Ensembl Gene ENSMUSG00000038502
Gene Nameprostate tumor over expressed gene 1
SynonymsGcap3, 1110030G05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R3005 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location44863067-44869788 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44864462 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 52 (N52S)
Ref Sequence ENSEMBL: ENSMUSP00000146633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003044] [ENSMUST00000046575] [ENSMUST00000098478] [ENSMUST00000107876] [ENSMUST00000123015] [ENSMUST00000124168] [ENSMUST00000139003] [ENSMUST00000155050] [ENSMUST00000200892] [ENSMUST00000201882] [ENSMUST00000202646] [ENSMUST00000207363] [ENSMUST00000209018]
Predicted Effect probably benign
Transcript: ENSMUST00000003044
SMART Domains Protein: ENSMUSP00000003044
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 4e-62 PDB
SCOP:d1lgpa_ 8 114 5e-12 SMART
Blast:FHA 31 74 1e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 327 9.3e-58 PFAM
low complexity region 350 364 N/A INTRINSIC
Pfam:AAA_33 366 488 1.6e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000046575
AA Change: N321S

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035281
Gene: ENSMUSG00000038502
AA Change: N321S

DomainStartEndE-ValueType
low complexity region 10 50 N/A INTRINSIC
low complexity region 64 82 N/A INTRINSIC
Pfam:Med25 89 238 1.7e-58 PFAM
Pfam:Med25 254 399 4.2e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098478
SMART Domains Protein: ENSMUSP00000096078
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 2e-62 PDB
SCOP:d1lgpa_ 8 114 5e-12 SMART
Blast:FHA 31 74 1e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 220 2.9e-16 PFAM
Pfam:PNK3P 211 291 5.3e-27 PFAM
low complexity region 314 328 N/A INTRINSIC
Pfam:AAA_33 330 452 5.6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107876
SMART Domains Protein: ENSMUSP00000103508
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 4e-62 PDB
SCOP:d1lgpa_ 8 114 5e-12 SMART
Blast:FHA 31 74 1e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 327 1.9e-57 PFAM
low complexity region 350 364 N/A INTRINSIC
Pfam:AAA_33 366 488 5.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123015
SMART Domains Protein: ENSMUSP00000143862
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJ5|C 1 143 8e-72 PDB
SCOP:d1lgpa_ 8 114 7e-13 SMART
Blast:FHA 31 74 2e-10 BLAST
PDB:3U7G|A 144 165 7e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000124168
SMART Domains Protein: ENSMUSP00000144330
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 51 3e-30 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126860
Predicted Effect probably benign
Transcript: ENSMUST00000139003
SMART Domains Protein: ENSMUSP00000143904
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 51 3e-30 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140732
AA Change: N543S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152747
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153085
AA Change: N137S
Predicted Effect probably benign
Transcript: ENSMUST00000155050
SMART Domains Protein: ENSMUSP00000144663
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 50 9e-30 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000200892
SMART Domains Protein: ENSMUSP00000144163
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
Pfam:AAA_33 18 100 3.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201882
SMART Domains Protein: ENSMUSP00000144690
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
PDB:1YJM|C 1 110 6e-63 PDB
SCOP:d1lgpa_ 8 114 3e-12 SMART
Blast:FHA 31 74 2e-10 BLAST
low complexity region 116 134 N/A INTRINSIC
Pfam:PNK3P 165 327 9.9e-55 PFAM
low complexity region 350 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202646
SMART Domains Protein: ENSMUSP00000144484
Gene: ENSMUSG00000002963

DomainStartEndE-ValueType
Pfam:AAA_33 5 44 6.1e-7 PFAM
Pfam:AAA_33 37 117 4.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207303
Predicted Effect probably damaging
Transcript: ENSMUST00000207363
AA Change: N52S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207393
Predicted Effect unknown
Transcript: ENSMUST00000207416
AA Change: N62S
Predicted Effect probably benign
Transcript: ENSMUST00000208385
Predicted Effect unknown
Transcript: ENSMUST00000208410
AA Change: N75S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208655
Predicted Effect probably benign
Transcript: ENSMUST00000208666
Predicted Effect probably benign
Transcript: ENSMUST00000208682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209003
Predicted Effect probably benign
Transcript: ENSMUST00000209018
AA Change: N17S

PolyPhen 2 Score 0.154 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209139
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was found to be overexpressed in prostate adenocarcinomas. The encoded protein was found to interact with the lipid raft protein flotillin-1 and shuttle it from the cytoplasm to the nucleus in a cell cycle dependent manner. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,259,959 N405K possibly damaging Het
4931406P16Rik T C 7: 34,284,784 E138G probably damaging Het
Cep162 C A 9: 87,232,060 V320L probably benign Het
Cnga1 T A 5: 72,605,107 I355F probably damaging Het
Csnk1e T C 15: 79,438,805 I15V probably benign Het
Exosc8 T C 3: 54,732,147 probably null Het
Gstm3 G T 3: 107,967,607 Q110K probably benign Het
Hace1 G A 10: 45,648,863 G242R probably damaging Het
Lcn6 T A 2: 25,677,249 probably null Het
Msh6 A G 17: 87,988,285 E1088G probably benign Het
Nlrp4c G A 7: 6,065,525 V142M probably benign Het
Nup50 G A 15: 84,929,460 probably null Het
Olfr577 C T 7: 102,973,258 V245I possibly damaging Het
Ppp2r5a A T 1: 191,358,976 F218Y probably damaging Het
Rif1 G A 2: 52,082,764 A303T probably damaging Het
Ror1 T A 4: 100,441,764 V778E probably damaging Het
Tcaf3 A T 6: 42,594,044 L258H probably damaging Het
Utp20 C A 10: 88,777,455 K1321N probably damaging Het
Vmn2r54 T A 7: 12,615,294 Q787L probably benign Het
Other mutations in Ptov1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01644:Ptov1 APN 7 44867502 nonsense probably null
IGL02217:Ptov1 APN 7 44867476 missense probably damaging 1.00
R0304:Ptov1 UTSW 7 44863449 splice site probably null
R0335:Ptov1 UTSW 7 44864622 missense possibly damaging 0.80
R0470:Ptov1 UTSW 7 44864811 missense probably damaging 0.96
R0787:Ptov1 UTSW 7 44865470 critical splice donor site probably null
R1844:Ptov1 UTSW 7 44865567 missense possibly damaging 0.95
R2185:Ptov1 UTSW 7 44867283 unclassified probably benign
R4460:Ptov1 UTSW 7 44865576 missense probably benign 0.01
R4731:Ptov1 UTSW 7 44867109 missense probably benign 0.23
R4732:Ptov1 UTSW 7 44867109 missense probably benign 0.23
R4733:Ptov1 UTSW 7 44867109 missense probably benign 0.23
R5063:Ptov1 UTSW 7 44865602 missense possibly damaging 0.52
R5356:Ptov1 UTSW 7 44864665 missense probably damaging 0.97
R5391:Ptov1 UTSW 7 44863584 missense probably damaging 0.98
R7998:Ptov1 UTSW 7 44864929 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGGATGGTGCATGCAAACAC -3'
(R):5'- TCATGCAGCTCATTCCGCAG -3'

Sequencing Primer
(F):5'- GGGTACAGGACATCCTAGCTG -3'
(R):5'- AGCTCATTCCGCAGCAGTTG -3'
Posted On2015-01-11