Incidental Mutation 'R3005:Olfr577'
ID257419
Institutional Source Beutler Lab
Gene Symbol Olfr577
Ensembl Gene ENSMUSG00000043354
Gene Nameolfactory receptor 577
SynonymsMOR7-2, GA_x6K02T2PBJ9-5685322-5684384
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R3005 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102971180-102975943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102973258 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 245 (V245I)
Ref Sequence ENSEMBL: ENSMUSP00000150712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051505] [ENSMUST00000185326] [ENSMUST00000214080] [ENSMUST00000215237]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051505
AA Change: V245I

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000059586
Gene: ENSMUSG00000043354
AA Change: V245I

DomainStartEndE-ValueType
Pfam:7tm_4 34 312 3.3e-140 PFAM
Pfam:7TM_GPCR_Srsx 38 310 1.2e-6 PFAM
Pfam:7tm_1 44 295 7.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185326
SMART Domains Protein: ENSMUSP00000142459
Gene: ENSMUSG00000073962

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 300 9.7e-12 PFAM
Pfam:7tm_1 41 291 1.8e-29 PFAM
Pfam:7tm_4 140 284 2.6e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214080
AA Change: V245I

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215237
AA Change: V245I

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,259,959 N405K possibly damaging Het
4931406P16Rik T C 7: 34,284,784 E138G probably damaging Het
Cep162 C A 9: 87,232,060 V320L probably benign Het
Cnga1 T A 5: 72,605,107 I355F probably damaging Het
Csnk1e T C 15: 79,438,805 I15V probably benign Het
Exosc8 T C 3: 54,732,147 probably null Het
Gstm3 G T 3: 107,967,607 Q110K probably benign Het
Hace1 G A 10: 45,648,863 G242R probably damaging Het
Lcn6 T A 2: 25,677,249 probably null Het
Msh6 A G 17: 87,988,285 E1088G probably benign Het
Nlrp4c G A 7: 6,065,525 V142M probably benign Het
Nup50 G A 15: 84,929,460 probably null Het
Ppp2r5a A T 1: 191,358,976 F218Y probably damaging Het
Ptov1 T C 7: 44,864,462 N52S probably damaging Het
Rif1 G A 2: 52,082,764 A303T probably damaging Het
Ror1 T A 4: 100,441,764 V778E probably damaging Het
Tcaf3 A T 6: 42,594,044 L258H probably damaging Het
Utp20 C A 10: 88,777,455 K1321N probably damaging Het
Vmn2r54 T A 7: 12,615,294 Q787L probably benign Het
Other mutations in Olfr577
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02246:Olfr577 APN 7 102973744 missense possibly damaging 0.62
IGL03111:Olfr577 APN 7 102973531 missense probably damaging 1.00
R1529:Olfr577 UTSW 7 102973879 missense probably damaging 1.00
R1753:Olfr577 UTSW 7 102973056 missense probably benign
R4457:Olfr577 UTSW 7 102973527 missense probably damaging 1.00
R4675:Olfr577 UTSW 7 102973806 missense probably damaging 0.99
R4808:Olfr577 UTSW 7 102973911 missense probably damaging 0.99
R4891:Olfr577 UTSW 7 102973552 missense probably benign 0.12
R4917:Olfr577 UTSW 7 102973407 missense possibly damaging 0.93
R4918:Olfr577 UTSW 7 102973407 missense possibly damaging 0.93
R5328:Olfr577 UTSW 7 102973968 missense possibly damaging 0.46
R6375:Olfr577 UTSW 7 102973753 missense probably damaging 1.00
R6683:Olfr577 UTSW 7 102973713 missense probably benign 0.05
R6958:Olfr577 UTSW 7 102973884 missense possibly damaging 0.67
R7022:Olfr577 UTSW 7 102973968 missense possibly damaging 0.46
R7429:Olfr577 UTSW 7 102973762 missense probably damaging 1.00
R7430:Olfr577 UTSW 7 102973762 missense probably damaging 1.00
R7490:Olfr577 UTSW 7 102973810 missense probably damaging 1.00
R7808:Olfr577 UTSW 7 102973110 missense possibly damaging 0.56
X0027:Olfr577 UTSW 7 102973686 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAGCATGTTCAGAGGTTGCAC -3'
(R):5'- TGAAACTGGCCTGTGCAGAC -3'

Sequencing Primer
(F):5'- AAGGCATGGGCTACCCTATC -3'
(R):5'- TGGCCTGTGCAGACATCAAG -3'
Posted On2015-01-11