Mutagenetix > Incidental Mutation

Incidental Mutation 'R3005:Cep162'

257420

Institutional Source

Beutler Lab

Gene Symbol

Cep162

Ensembl Gene

ENSMUSG00000056919

Gene Name

centrosomal protein 162

Synonyms

4922501C03Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.205) question?

Stock #

R3005 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87189577-87255536 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 87232060 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 320 (V320L)

Ref Sequence

ENSEMBL: ENSMUSP00000091319 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093802]

AlphaFold

Q6ZQ06

Predicted Effect

probably benign
Transcript: ENSMUST00000093802
AA Change: V320L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000091319
Gene: ENSMUSG00000056919
AA Change: V320L

Domain	Start	End	E-Value	Type
low complexity region	198	208	N/A	INTRINSIC
low complexity region	528	539	N/A	INTRINSIC
coiled coil region	630	674	N/A	INTRINSIC
coiled coil region	695	899	N/A	INTRINSIC
coiled coil region	953	1124	N/A	INTRINSIC
coiled coil region	1235	1386	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144137

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188289

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	A	18: 38,259,959	N405K	possibly damaging	Het
4931406P16Rik	T	C	7: 34,284,784	E138G	probably damaging	Het
Cnga1	T	A	5: 72,605,107	I355F	probably damaging	Het
Csnk1e	T	C	15: 79,438,805	I15V	probably benign	Het
Exosc8	T	C	3: 54,732,147		probably null	Het
Gstm3	G	T	3: 107,967,607	Q110K	probably benign	Het
Hace1	G	A	10: 45,648,863	G242R	probably damaging	Het
Lcn6	T	A	2: 25,677,249		probably null	Het
Msh6	A	G	17: 87,988,285	E1088G	probably benign	Het
Nlrp4c	G	A	7: 6,065,525	V142M	probably benign	Het
Nup50	G	A	15: 84,929,460		probably null	Het
Olfr577	C	T	7: 102,973,258	V245I	possibly damaging	Het
Ppp2r5a	A	T	1: 191,358,976	F218Y	probably damaging	Het
Ptov1	T	C	7: 44,864,462	N52S	probably damaging	Het
Rif1	G	A	2: 52,082,764	A303T	probably damaging	Het
Ror1	T	A	4: 100,441,764	V778E	probably damaging	Het
Tcaf3	A	T	6: 42,594,044	L258H	probably damaging	Het
Utp20	C	A	10: 88,777,455	K1321N	probably damaging	Het
Vmn2r54	T	A	7: 12,615,294	Q787L	probably benign	Het

Other mutations in Cep162

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Cep162	APN	9	87227167	missense	probably benign	0.24
IGL00584:Cep162	APN	9	87221090	splice site	probably benign
IGL01387:Cep162	APN	9	87211811	missense	probably benign	0.08
IGL01862:Cep162	APN	9	87253933	missense	possibly damaging	0.90
IGL02304:Cep162	APN	9	87227147	splice site	probably benign
IGL02558:Cep162	APN	9	87225733	missense	probably benign	0.04
IGL02558:Cep162	APN	9	87225726	missense	probably benign
IGL02602:Cep162	APN	9	87246153	missense	probably benign	0.19
IGL02636:Cep162	APN	9	87248379	missense	possibly damaging	0.90
IGL02680:Cep162	APN	9	87246744	missense	possibly damaging	0.64
IGL03195:Cep162	APN	9	87225786	missense	probably benign	0.00
circus	UTSW	9	87206862	missense	probably damaging	1.00
moscow	UTSW	9	87193697	missense	probably damaging	1.00
smiley	UTSW	9	87217081	nonsense	probably null
PIT4378001:Cep162	UTSW	9	87217145	missense	probably benign	0.01
PIT4431001:Cep162	UTSW	9	87244345	missense	probably benign	0.00
PIT4434001:Cep162	UTSW	9	87193648	missense	probably damaging	1.00
R0060:Cep162	UTSW	9	87237825	splice site	probably benign
R0218:Cep162	UTSW	9	87211809	missense	possibly damaging	0.73
R0366:Cep162	UTSW	9	87220484	missense	probably damaging	0.96
R0468:Cep162	UTSW	9	87193697	missense	probably damaging	1.00
R0764:Cep162	UTSW	9	87201745	missense	probably damaging	1.00
R1386:Cep162	UTSW	9	87221202	missense	probably benign
R1614:Cep162	UTSW	9	87212932	missense	probably damaging	1.00
R1633:Cep162	UTSW	9	87203683	missense	probably benign	0.23
R1831:Cep162	UTSW	9	87206932	missense	probably damaging	1.00
R1847:Cep162	UTSW	9	87204080	missense	probably benign	0.06
R1941:Cep162	UTSW	9	87199995	missense	probably benign	0.14
R2228:Cep162	UTSW	9	87244331	missense	probably benign	0.05
R2256:Cep162	UTSW	9	87206914	missense	probably damaging	1.00
R2257:Cep162	UTSW	9	87206914	missense	probably damaging	1.00
R2936:Cep162	UTSW	9	87227414	missense	probably benign
R3508:Cep162	UTSW	9	87231977	critical splice donor site	probably null
R3689:Cep162	UTSW	9	87225694	nonsense	probably null
R3743:Cep162	UTSW	9	87217177	splice site	probably benign
R4118:Cep162	UTSW	9	87204176	missense	probably benign	0.30
R4380:Cep162	UTSW	9	87200003	missense	probably damaging	0.99
R4450:Cep162	UTSW	9	87225808	missense	probably damaging	1.00
R4540:Cep162	UTSW	9	87212939	missense	probably damaging	1.00
R4598:Cep162	UTSW	9	87203795	missense	possibly damaging	0.95
R4700:Cep162	UTSW	9	87206862	missense	probably damaging	1.00
R4941:Cep162	UTSW	9	87225969	intron	probably benign
R5356:Cep162	UTSW	9	87206895	missense	probably damaging	1.00
R5468:Cep162	UTSW	9	87227237	missense	probably benign	0.00
R5579:Cep162	UTSW	9	87203671	missense	probably benign	0.26
R5859:Cep162	UTSW	9	87204092	missense	probably damaging	1.00
R6114:Cep162	UTSW	9	87203710	missense	probably benign
R6143:Cep162	UTSW	9	87212851	critical splice donor site	probably null
R6422:Cep162	UTSW	9	87232016	missense	possibly damaging	0.92
R6517:Cep162	UTSW	9	87222174	missense	probably damaging	0.99
R6576:Cep162	UTSW	9	87217145	missense	probably benign	0.01
R6782:Cep162	UTSW	9	87211684	missense	probably benign	0.07
R6867:Cep162	UTSW	9	87217081	nonsense	probably null
R7293:Cep162	UTSW	9	87203783	missense	probably benign	0.01
R7355:Cep162	UTSW	9	87253955	nonsense	probably null
R7391:Cep162	UTSW	9	87248494	nonsense	probably null
R7426:Cep162	UTSW	9	87192766	missense	probably damaging	1.00
R7593:Cep162	UTSW	9	87204197	missense	probably benign	0.40
R7710:Cep162	UTSW	9	87232119	missense	probably damaging	1.00
R7841:Cep162	UTSW	9	87244316	missense	probably benign	0.00
R7949:Cep162	UTSW	9	87206848	missense	probably benign	0.04
R8351:Cep162	UTSW	9	87192850	nonsense	probably null
R8451:Cep162	UTSW	9	87192850	nonsense	probably null
R8552:Cep162	UTSW	9	87244308	missense	probably benign	0.34
R8755:Cep162	UTSW	9	87232011	missense	probably benign	0.02
R8762:Cep162	UTSW	9	87227261	missense	probably benign	0.00
R9640:Cep162	UTSW	9	87244299	missense	probably benign	0.06
X0063:Cep162	UTSW	9	87222042	critical splice donor site	probably null
Z1177:Cep162	UTSW	9	87199980	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GGGTTTCATTTGATCACGCC -3'
(R):5'- TCCGGAATGACTCTGTTTTGTC -3'

Sequencing Primer
(F):5'- TTTGATCACGCCCATTACATTCAAAC -3'
(R):5'- CTGTATGAGGTGATGCACAGG -3'

Posted On

2015-01-11