Mutagenetix > Incidental Mutations

Incidental Mutation 'R3005:Utp20'

257422

Institutional Source

Beutler Lab

Gene Symbol

Utp20

Ensembl Gene

ENSMUSG00000004356

Gene Name

UTP20 small subunit processome component

Synonyms

3830408P06Rik, DRIM, mDRIM

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R3005 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88746607-88826804 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 88777455 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 1321 (K1321N)

Ref Sequence

ENSEMBL: ENSMUSP00000004470 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004470]

Predicted Effect

probably damaging
Transcript: ENSMUST00000004470
AA Change: K1321N

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: K1321N

Domain	Start	End	E-Value	Type
low complexity region	244	255	N/A	INTRINSIC
low complexity region	442	454	N/A	INTRINSIC
low complexity region	571	581	N/A	INTRINSIC
low complexity region	695	704	N/A	INTRINSIC
Pfam:DRIM	910	1534	2.6e-176	PFAM
low complexity region	1585	1598	N/A	INTRINSIC
low complexity region	1705	1719	N/A	INTRINSIC
low complexity region	2503	2513	N/A	INTRINSIC
low complexity region	2589	2605	N/A	INTRINSIC
low complexity region	2727	2737	N/A	INTRINSIC
low complexity region	2746	2764	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000219662

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220275

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	A	18: 38,259,959	N405K	possibly damaging	Het
4931406P16Rik	T	C	7: 34,284,784	E138G	probably damaging	Het
Cep162	C	A	9: 87,232,060	V320L	probably benign	Het
Cnga1	T	A	5: 72,605,107	I355F	probably damaging	Het
Csnk1e	T	C	15: 79,438,805	I15V	probably benign	Het
Exosc8	T	C	3: 54,732,147		probably null	Het
Gstm3	G	T	3: 107,967,607	Q110K	probably benign	Het
Hace1	G	A	10: 45,648,863	G242R	probably damaging	Het
Lcn6	T	A	2: 25,677,249		probably null	Het
Msh6	A	G	17: 87,988,285	E1088G	probably benign	Het
Nlrp4c	G	A	7: 6,065,525	V142M	probably benign	Het
Nup50	G	A	15: 84,929,460		probably null	Het
Olfr577	C	T	7: 102,973,258	V245I	possibly damaging	Het
Ppp2r5a	A	T	1: 191,358,976	F218Y	probably damaging	Het
Ptov1	T	C	7: 44,864,462	N52S	probably damaging	Het
Rif1	G	A	2: 52,082,764	A303T	probably damaging	Het
Ror1	T	A	4: 100,441,764	V778E	probably damaging	Het
Tcaf3	A	T	6: 42,594,044	L258H	probably damaging	Het
Vmn2r54	T	A	7: 12,615,294	Q787L	probably benign	Het

Other mutations in Utp20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Utp20	APN	10	88825444	missense	possibly damaging	0.90
IGL00858:Utp20	APN	10	88809125	missense	possibly damaging	0.69
IGL00858:Utp20	APN	10	88809138	missense	probably benign
IGL00946:Utp20	APN	10	88748315	missense	possibly damaging	0.82
IGL01061:Utp20	APN	10	88770704	missense	probably benign	0.13
IGL01399:Utp20	APN	10	88758302	critical splice donor site	probably null
IGL01548:Utp20	APN	10	88764781	missense	probably damaging	1.00
IGL01587:Utp20	APN	10	88787535	missense	probably damaging	0.98
IGL01789:Utp20	APN	10	88798279	critical splice donor site	probably null
IGL01819:Utp20	APN	10	88792687	missense	probably damaging	1.00
IGL02070:Utp20	APN	10	88821877	splice site	probably benign
IGL02231:Utp20	APN	10	88791168	missense	probably damaging	1.00
IGL02244:Utp20	APN	10	88815956	splice site	probably benign
IGL02367:Utp20	APN	10	88771853	unclassified	probably benign
IGL02553:Utp20	APN	10	88764795	missense	probably damaging	0.99
IGL02748:Utp20	APN	10	88817295	missense	probably benign	0.00
IGL02831:Utp20	APN	10	88815908	missense	probably benign
IGL02986:Utp20	APN	10	88775285	missense	probably damaging	1.00
IGL02997:Utp20	APN	10	88814034	missense	probably benign
IGL03105:Utp20	APN	10	88791096	missense	probably benign	0.10
IGL03251:Utp20	APN	10	88817326	critical splice acceptor site	probably null
IGL03337:Utp20	APN	10	88754566	missense	probably benign
IGL03348:Utp20	APN	10	88758317	missense	probably benign	0.09
IGL03381:Utp20	APN	10	88822005	missense	probably damaging	0.99
R0037:Utp20	UTSW	10	88798404	missense	probably benign	0.05
R0107:Utp20	UTSW	10	88778391	missense	probably benign	0.03
R0197:Utp20	UTSW	10	88777516	missense	probably benign	0.22
R0219:Utp20	UTSW	10	88764675	missense	probably damaging	1.00
R0315:Utp20	UTSW	10	88807421	missense	probably damaging	1.00
R0328:Utp20	UTSW	10	88767107	missense	possibly damaging	0.82
R0329:Utp20	UTSW	10	88817979	missense	probably benign	0.00
R0330:Utp20	UTSW	10	88817979	missense	probably benign	0.00
R0395:Utp20	UTSW	10	88818595	missense	probably damaging	1.00
R0399:Utp20	UTSW	10	88820979	missense	probably damaging	1.00
R0454:Utp20	UTSW	10	88822069	missense	probably benign	0.00
R0456:Utp20	UTSW	10	88754573	missense	possibly damaging	0.92
R0491:Utp20	UTSW	10	88760912	missense	probably damaging	1.00
R0557:Utp20	UTSW	10	88748311	missense	probably damaging	0.99
R0600:Utp20	UTSW	10	88767461	missense	probably damaging	1.00
R0616:Utp20	UTSW	10	88770751	missense	probably benign	0.14
R1076:Utp20	UTSW	10	88772459	missense	probably benign	0.36
R1076:Utp20	UTSW	10	88772543	missense	possibly damaging	0.86
R1330:Utp20	UTSW	10	88801189	missense	probably damaging	0.96
R1440:Utp20	UTSW	10	88819339	missense	probably benign	0.19
R1529:Utp20	UTSW	10	88753006	missense	probably damaging	1.00
R1554:Utp20	UTSW	10	88764737	nonsense	probably null
R1621:Utp20	UTSW	10	88762871	missense	probably benign
R1641:Utp20	UTSW	10	88757972	missense	possibly damaging	0.82
R1709:Utp20	UTSW	10	88749297	missense	probably benign	0.29
R1734:Utp20	UTSW	10	88767461	missense	probably damaging	1.00
R1755:Utp20	UTSW	10	88809769	missense	probably benign	0.01
R1775:Utp20	UTSW	10	88770808	missense	probably benign
R1866:Utp20	UTSW	10	88762770	nonsense	probably null
R1867:Utp20	UTSW	10	88749443	missense	probably benign
R1901:Utp20	UTSW	10	88753026	missense	probably benign	0.02
R1902:Utp20	UTSW	10	88753026	missense	probably benign	0.02
R1967:Utp20	UTSW	10	88816979	missense	probably benign	0.03
R2060:Utp20	UTSW	10	88774795	missense	probably damaging	0.98
R2102:Utp20	UTSW	10	88772917	missense	probably damaging	0.99
R2110:Utp20	UTSW	10	88767451	critical splice donor site	probably null
R2115:Utp20	UTSW	10	88786003	missense	probably benign	0.02
R2128:Utp20	UTSW	10	88814055	missense	probably damaging	0.99
R2129:Utp20	UTSW	10	88814055	missense	probably damaging	0.99
R2180:Utp20	UTSW	10	88820939	missense	probably damaging	0.98
R2280:Utp20	UTSW	10	88825503	splice site	probably null
R2435:Utp20	UTSW	10	88820891	missense	possibly damaging	0.89
R2914:Utp20	UTSW	10	88754475	critical splice donor site	probably null
R3546:Utp20	UTSW	10	88782689	missense	probably damaging	1.00
R3547:Utp20	UTSW	10	88782689	missense	probably damaging	1.00
R3622:Utp20	UTSW	10	88757993	unclassified	probably benign
R3737:Utp20	UTSW	10	88762806	missense	probably benign	0.00
R3738:Utp20	UTSW	10	88762806	missense	probably benign	0.00
R3841:Utp20	UTSW	10	88775203	unclassified	probably benign
R4034:Utp20	UTSW	10	88762806	missense	probably benign	0.00
R4035:Utp20	UTSW	10	88762806	missense	probably benign	0.00
R4157:Utp20	UTSW	10	88761867	missense	probably benign
R4243:Utp20	UTSW	10	88807325	critical splice donor site	probably null
R4295:Utp20	UTSW	10	88754519	missense	possibly damaging	0.54
R4632:Utp20	UTSW	10	88778261	missense	probably damaging	1.00
R4633:Utp20	UTSW	10	88752952	missense	probably benign
R4684:Utp20	UTSW	10	88807445	nonsense	probably null
R4731:Utp20	UTSW	10	88754520	missense	possibly damaging	0.93
R4735:Utp20	UTSW	10	88816918	missense	possibly damaging	0.91
R4772:Utp20	UTSW	10	88809935	missense	probably benign	0.09
R4912:Utp20	UTSW	10	88771960	missense	probably benign	0.01
R4974:Utp20	UTSW	10	88816949	missense	probably benign	0.08
R4991:Utp20	UTSW	10	88746934	missense	probably benign	0.09
R5004:Utp20	UTSW	10	88748273	missense	probably damaging	0.98
R5037:Utp20	UTSW	10	88775330	missense	probably benign	0.00
R5043:Utp20	UTSW	10	88798746	missense	possibly damaging	0.70
R5108:Utp20	UTSW	10	88768873	missense	probably benign	0.00
R5138:Utp20	UTSW	10	88747377	missense	probably damaging	0.96
R5252:Utp20	UTSW	10	88750670	missense	probably benign	0.01
R5394:Utp20	UTSW	10	88772915	nonsense	probably null
R5470:Utp20	UTSW	10	88817896	missense	probably benign	0.14
R5558:Utp20	UTSW	10	88751467	missense	probably damaging	1.00
R5678:Utp20	UTSW	10	88809117	missense	probably benign	0.00
R5822:Utp20	UTSW	10	88817285	missense	probably benign	0.00
R5866:Utp20	UTSW	10	88772559	missense	possibly damaging	0.82
R5924:Utp20	UTSW	10	88815922	missense	probably benign	0.00
R6026:Utp20	UTSW	10	88768679	missense	probably benign	0.04
R6363:Utp20	UTSW	10	88757080	missense	probably damaging	1.00
R6434:Utp20	UTSW	10	88772533	nonsense	probably null
R6477:Utp20	UTSW	10	88768918	missense	probably benign	0.05
R6480:Utp20	UTSW	10	88755186	critical splice donor site	probably null
R6989:Utp20	UTSW	10	88778240	missense	probably benign	0.00
R7033:Utp20	UTSW	10	88754475	critical splice donor site	probably null
R7192:Utp20	UTSW	10	88772459	missense	probably benign	0.09
R7236:Utp20	UTSW	10	88749342	missense	probably benign	0.28
R7260:Utp20	UTSW	10	88751472	missense	probably benign	0.39
R7296:Utp20	UTSW	10	88770724	missense	probably benign	0.21
R7317:Utp20	UTSW	10	88762935	missense	possibly damaging	0.83
R7318:Utp20	UTSW	10	88813949	missense	possibly damaging	0.89
R7330:Utp20	UTSW	10	88787562	frame shift	probably null
R7367:Utp20	UTSW	10	88795443	missense	probably benign	0.21
R7432:Utp20	UTSW	10	88798398	missense	probably benign	0.00
R7447:Utp20	UTSW	10	88772492	missense	probably damaging	1.00
R7520:Utp20	UTSW	10	88818595	missense	probably damaging	1.00
R7530:Utp20	UTSW	10	88753006	missense	probably damaging	1.00
R7539:Utp20	UTSW	10	88791745	missense	probably damaging	1.00
R7651:Utp20	UTSW	10	88754595	missense	probably benign	0.41
R7728:Utp20	UTSW	10	88798341	missense	probably damaging	1.00
R7831:Utp20	UTSW	10	88762770	nonsense	probably null
R7833:Utp20	UTSW	10	88801136	missense	possibly damaging	0.92
R7909:Utp20	UTSW	10	88775330	missense	probably benign
R7914:Utp20	UTSW	10	88762770	nonsense	probably null
R7916:Utp20	UTSW	10	88801136	missense	possibly damaging	0.92
R7990:Utp20	UTSW	10	88775330	missense	probably benign
R7999:Utp20	UTSW	10	88770388	missense	not run
RF005:Utp20	UTSW	10	88825457	missense	probably damaging	1.00
RF024:Utp20	UTSW	10	88825457	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCTGTTGCCACTCATAGAG -3'
(R):5'- GTTCGTGAATAATTGAGTGCTTTCC -3'

Sequencing Primer
(F):5'- GCTGGAGATTAGACCCAGTACC -3'
(R):5'- GAGTGCTTTCCTTATTTGTCATCAAG -3'

Posted On

2015-01-11