Incidental Mutation 'R3005:Csnk1e'
ID257424
Institutional Source Beutler Lab
Gene Symbol Csnk1e
Ensembl Gene ENSMUSG00000022433
Gene Namecasein kinase 1, epsilon
SynonymsCKIepsilon, KC1epsilon, CKI epsilon, CK1epsilon, tau
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3005 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location79417856-79455566 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79438805 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 15 (I15V)
Ref Sequence ENSEMBL: ENSMUSP00000155731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117786] [ENSMUST00000120859] [ENSMUST00000122044] [ENSMUST00000135519] [ENSMUST00000144790] [ENSMUST00000156043] [ENSMUST00000230599] [ENSMUST00000230942]
Predicted Effect probably benign
Transcript: ENSMUST00000117786
AA Change: I15V

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113341
Gene: ENSMUSG00000022433
AA Change: I15V

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 8.7e-18 PFAM
Pfam:Pkinase 9 277 5.2e-28 PFAM
low complexity region 306 316 N/A INTRINSIC
low complexity region 329 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120859
AA Change: I15V

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113975
Gene: ENSMUSG00000022433
AA Change: I15V

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 9.8e-18 PFAM
Pfam:Pkinase 9 280 7e-40 PFAM
low complexity region 306 316 N/A INTRINSIC
low complexity region 329 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122044
AA Change: I15V

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113096
Gene: ENSMUSG00000022433
AA Change: I15V

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 7.9e-18 PFAM
Pfam:Pkinase 9 280 5.7e-40 PFAM
low complexity region 309 324 N/A INTRINSIC
low complexity region 345 350 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135519
AA Change: I15V

PolyPhen 2 Score 0.318 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122135
Gene: ENSMUSG00000022433
AA Change: I15V

DomainStartEndE-ValueType
Pfam:Pkinase 9 118 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144790
AA Change: I15V

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000115637
Gene: ENSMUSG00000022433
AA Change: I15V

DomainStartEndE-ValueType
Pfam:Pkinase 9 141 9.3e-24 PFAM
Pfam:Pkinase_Tyr 9 141 5.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156043
AA Change: I15V

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116593
Gene: ENSMUSG00000022433
AA Change: I15V

DomainStartEndE-ValueType
Pfam:Pkinase 9 60 1.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230599
AA Change: I15V

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000230942
AA Change: I15V

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a serine/threonine protein kinase and a member of the casein kinase I protein family, whose members have been implicated in the control of cytoplasmic and nuclear processes, including DNA replication and repair. The encoded protein is found in the cytoplasm as a monomer and can phosphorylate a variety of proteins, including itself. This protein has been shown to phosphorylate period, a circadian rhythm protein. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit disruptions in circadian rhythms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,259,959 N405K possibly damaging Het
4931406P16Rik T C 7: 34,284,784 E138G probably damaging Het
Cep162 C A 9: 87,232,060 V320L probably benign Het
Cnga1 T A 5: 72,605,107 I355F probably damaging Het
Exosc8 T C 3: 54,732,147 probably null Het
Gstm3 G T 3: 107,967,607 Q110K probably benign Het
Hace1 G A 10: 45,648,863 G242R probably damaging Het
Lcn6 T A 2: 25,677,249 probably null Het
Msh6 A G 17: 87,988,285 E1088G probably benign Het
Nlrp4c G A 7: 6,065,525 V142M probably benign Het
Nup50 G A 15: 84,929,460 probably null Het
Olfr577 C T 7: 102,973,258 V245I possibly damaging Het
Ppp2r5a A T 1: 191,358,976 F218Y probably damaging Het
Ptov1 T C 7: 44,864,462 N52S probably damaging Het
Rif1 G A 2: 52,082,764 A303T probably damaging Het
Ror1 T A 4: 100,441,764 V778E probably damaging Het
Tcaf3 A T 6: 42,594,044 L258H probably damaging Het
Utp20 C A 10: 88,777,455 K1321N probably damaging Het
Vmn2r54 T A 7: 12,615,294 Q787L probably benign Het
Other mutations in Csnk1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0624:Csnk1e UTSW 15 79419898 unclassified probably benign
R1281:Csnk1e UTSW 15 79420641 missense possibly damaging 0.80
R1618:Csnk1e UTSW 15 79424850 missense probably benign 0.02
R4241:Csnk1e UTSW 15 79424895 missense probably damaging 1.00
R4242:Csnk1e UTSW 15 79424895 missense probably damaging 1.00
R4276:Csnk1e UTSW 15 79429767 missense probably damaging 1.00
R4438:Csnk1e UTSW 15 79420929 missense probably benign 0.08
R4994:Csnk1e UTSW 15 79424929 missense probably damaging 1.00
R5071:Csnk1e UTSW 15 79420872 nonsense probably null
R7072:Csnk1e UTSW 15 79438767 splice site probably null
R7553:Csnk1e UTSW 15 79426366 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGTGAAAGAAGACATTCCCC -3'
(R):5'- AGCTAAGTGAAGCCAGATTGC -3'

Sequencing Primer
(F):5'- GAGCTTCCTTCTGGATCCGG -3'
(R):5'- AGCCAGATTGCTTCTCAGACAGTG -3'
Posted On2015-01-11