Incidental Mutation 'R3005:Nup50'
ID257425
Institutional Source Beutler Lab
Gene Symbol Nup50
Ensembl Gene ENSMUSG00000016619
Gene Namenucleoporin 50
Synonyms1700030K07Rik, Npap60
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3005 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location84923411-84942963 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 84929460 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165443] [ENSMUST00000230411]
Predicted Effect probably null
Transcript: ENSMUST00000165443
SMART Domains Protein: ENSMUSP00000131457
Gene: ENSMUSG00000016619

DomainStartEndE-ValueType
Pfam:NUP50 2 80 1.2e-22 PFAM
low complexity region 277 302 N/A INTRINSIC
RanBD 340 463 4.83e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000230411
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene is a member of the FG-repeat containing nucleoporins that functions as a soluble cofactor in importin-alpha:beta-mediated nuclear protein import. Pseudogenes of this gene are found on chromosomes 5, 6, and 14. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation die perinatally, displaying neural tube defects, exencephaly, and intrauterine growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,259,959 N405K possibly damaging Het
4931406P16Rik T C 7: 34,284,784 E138G probably damaging Het
Cep162 C A 9: 87,232,060 V320L probably benign Het
Cnga1 T A 5: 72,605,107 I355F probably damaging Het
Csnk1e T C 15: 79,438,805 I15V probably benign Het
Exosc8 T C 3: 54,732,147 probably null Het
Gstm3 G T 3: 107,967,607 Q110K probably benign Het
Hace1 G A 10: 45,648,863 G242R probably damaging Het
Lcn6 T A 2: 25,677,249 probably null Het
Msh6 A G 17: 87,988,285 E1088G probably benign Het
Nlrp4c G A 7: 6,065,525 V142M probably benign Het
Olfr577 C T 7: 102,973,258 V245I possibly damaging Het
Ppp2r5a A T 1: 191,358,976 F218Y probably damaging Het
Ptov1 T C 7: 44,864,462 N52S probably damaging Het
Rif1 G A 2: 52,082,764 A303T probably damaging Het
Ror1 T A 4: 100,441,764 V778E probably damaging Het
Tcaf3 A T 6: 42,594,044 L258H probably damaging Het
Utp20 C A 10: 88,777,455 K1321N probably damaging Het
Vmn2r54 T A 7: 12,615,294 Q787L probably benign Het
Other mutations in Nup50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Nup50 APN 15 84935404 missense probably benign 0.33
IGL00939:Nup50 APN 15 84938420 nonsense probably null
R1483:Nup50 UTSW 15 84939727 missense probably damaging 1.00
R1545:Nup50 UTSW 15 84939792 missense possibly damaging 0.51
R2504:Nup50 UTSW 15 84933658 missense probably benign 0.00
R3690:Nup50 UTSW 15 84939793 missense probably damaging 1.00
R4851:Nup50 UTSW 15 84939711 missense probably benign 0.03
R5902:Nup50 UTSW 15 84935440 missense probably benign 0.00
R7205:Nup50 UTSW 15 84933658 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGCCAGATAAGTGTTTGTGCTC -3'
(R):5'- GTCACTTACTGAACAGCCAGATC -3'

Sequencing Primer
(F):5'- AAGTGTTTGTGCTCAGTTTTACTCTC -3'
(R):5'- TCAGTCCTCGCCATGAGC -3'
Posted On2015-01-11