Mutagenetix > Incidental Mutations

Incidental Mutation 'R3005:0610009O20Rik'

List |< first << previous [record 15 of 523071] next >> last >|

257428

Institutional Source

Beutler Lab

Gene Symbol

0610009O20Rik

Ensembl Gene

ENSMUSG00000024442

Gene Name

RIKEN cDNA 0610009O20 gene

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.235) question?

Stock #

R3005 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

38250249-38262629 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 38259959 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 405 (N405K)

Ref Sequence

ENSEMBL: ENSMUSP00000025314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025314]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025314
AA Change: N405K

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000025314
Gene: ENSMUSG00000024442
AA Change: N405K

Domain	Start	End	E-Value	Type
low complexity region	6	23	N/A	INTRINSIC
low complexity region	35	46	N/A	INTRINSIC
low complexity region	127	140	N/A	INTRINSIC
SEL1	244	277	1.53e2	SMART
SEL1	278	313	2.8e-9	SMART
SEL1	314	351	3.3e1	SMART
SEL1	352	385	1.31e0	SMART
SEL1	386	421	1.67e-7	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	T	C	7: 34,284,784	E138G	probably damaging	Het
Cep162	C	A	9: 87,232,060	V320L	probably benign	Het
Cnga1	T	A	5: 72,605,107	I355F	probably damaging	Het
Csnk1e	T	C	15: 79,438,805	I15V	probably benign	Het
Exosc8	T	C	3: 54,732,147		probably null	Het
Gstm3	G	T	3: 107,967,607	Q110K	probably benign	Het
Hace1	G	A	10: 45,648,863	G242R	probably damaging	Het
Lcn6	T	A	2: 25,677,249		probably null	Het
Msh6	A	G	17: 87,988,285	E1088G	probably benign	Het
Nlrp4c	G	A	7: 6,065,525	V142M	probably benign	Het
Nup50	G	A	15: 84,929,460		probably null	Het
Olfr577	C	T	7: 102,973,258	V245I	possibly damaging	Het
Ppp2r5a	A	T	1: 191,358,976	F218Y	probably damaging	Het
Ptov1	T	C	7: 44,864,462	N52S	probably damaging	Het
Rif1	G	A	2: 52,082,764	A303T	probably damaging	Het
Ror1	T	A	4: 100,441,764	V778E	probably damaging	Het
Tcaf3	A	T	6: 42,594,044	L258H	probably damaging	Het
Utp20	C	A	10: 88,777,455	K1321N	probably damaging	Het
Vmn2r54	T	A	7: 12,615,294	Q787L	probably benign	Het

Other mutations in 0610009O20Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02216:0610009O20Rik	APN	18	38252860	missense	probably damaging	0.96
IGL02456:0610009O20Rik	APN	18	38261124	missense	probably damaging	1.00
R0134:0610009O20Rik	UTSW	18	38261264	missense	probably benign	0.37
R0225:0610009O20Rik	UTSW	18	38261264	missense	probably benign	0.37
R0511:0610009O20Rik	UTSW	18	38254071	critical splice donor site	probably null
R0560:0610009O20Rik	UTSW	18	38254498	missense	probably damaging	1.00
R1899:0610009O20Rik	UTSW	18	38258342	missense	probably benign	0.04
R3552:0610009O20Rik	UTSW	18	38258365	splice site	probably benign
R4418:0610009O20Rik	UTSW	18	38261287	critical splice donor site	probably null
R7448:0610009O20Rik	UTSW	18	38257266	missense	probably damaging	1.00
R7671:0610009O20Rik	UTSW	18	38259925	missense	probably damaging	0.99
Z1177:0610009O20Rik	UTSW	18	38254303	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCGTTTCATGATCAAGGAGC -3'
(R):5'- ACTCTGAAAGCTGGCCTTCTAAC -3'

Sequencing Primer
(F):5'- TTCATGATCAAGGAGCTTGGAATG -3'
(R):5'- GAAAGCTGGCCTTCTAACTCCTG -3'

Posted On

2015-01-11