Incidental Mutation 'R3008:Cldn19'
ID257435
Institutional Source Beutler Lab
Gene Symbol Cldn19
Ensembl Gene ENSMUSG00000066058
Gene Nameclaudin 19
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3008 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location119255414-119262438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 119255790 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 73 (L73R)
Ref Sequence ENSEMBL: ENSMUSP00000092418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084309] [ENSMUST00000094823]
Predicted Effect probably damaging
Transcript: ENSMUST00000084309
AA Change: L73R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081334
Gene: ENSMUSG00000066058
AA Change: L73R

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 182 5.8e-45 PFAM
Pfam:Claudin_2 15 184 1.1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094823
AA Change: L73R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092418
Gene: ENSMUSG00000066058
AA Change: L73R

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 182 6.1e-43 PFAM
Pfam:Claudin_2 15 184 2.6e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150252
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. siRNA knockdown of this gene in mice develops the FHHNC (familial hypomagnesemia with hypercalciuria and nephrocalcinosis) symptoms of chronic renal wasting of magnesium and calcium together with defective renal salt handling. The protein encoded by this gene interacts with another family member, Claudin 16, and their interaction is required for their assembly into tight junctions and for renal reabsorption of magnesium. This protein is a constituent of tight junctions in the Schwann cells of peripheral myelinated nerves and the gene deficiency affects the nerve conduction of peripheral myelinated fibers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a peripheral neuropathy associated with significant behavioral abnormalities, a complete lack of tight junctions from myelinated Schwann cells, and abnormal nerve conduction parameters of peripheral myelinated fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 T C 4: 155,905,682 I773T probably benign Het
Atm A C 9: 53,480,750 F1780V probably benign Het
Cers5 A G 15: 99,772,717 probably benign Het
Cntnap5c A G 17: 58,359,209 Y1078C probably damaging Het
Foxo6 A T 4: 120,268,764 M278K probably benign Het
Gm10277 T A 11: 77,785,536 probably benign Het
Gm4871 A T 5: 145,029,817 D285E probably damaging Het
Gm5538 T C 3: 59,745,509 L123P possibly damaging Het
Gpd2 C T 2: 57,338,975 R264* probably null Het
Ighv1-85 A T 12: 116,000,084 Y99N probably damaging Het
Ighv7-1 A T 12: 113,896,451 L107Q probably damaging Het
Kif17 A G 4: 138,278,165 D347G probably damaging Het
Med22 T C 2: 26,908,384 probably benign Het
Mme T A 3: 63,358,957 N551K probably damaging Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Muc2 A T 7: 141,695,104 H475L possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr282 G A 15: 98,437,976 C169Y probably damaging Het
Pdp2 T A 8: 104,594,266 I249N probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Slc26a9 G T 1: 131,765,914 G714V probably damaging Het
Tarbp1 G A 8: 126,447,421 T882I possibly damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Ubr5 A G 15: 38,030,845 S398P probably benign Het
Other mutations in Cldn19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02560:Cldn19 APN 4 119255724 nonsense probably null
R1459:Cldn19 UTSW 4 119255613 missense probably damaging 1.00
R1524:Cldn19 UTSW 4 119257051 critical splice donor site probably null
R1828:Cldn19 UTSW 4 119255793 missense probably benign 0.00
R3709:Cldn19 UTSW 4 119256897 missense possibly damaging 0.70
R3877:Cldn19 UTSW 4 119256897 missense possibly damaging 0.70
R4840:Cldn19 UTSW 4 119255754 missense probably damaging 1.00
R5238:Cldn19 UTSW 4 119255733 missense probably damaging 1.00
R5629:Cldn19 UTSW 4 119256919 missense probably damaging 0.98
R7407:Cldn19 UTSW 4 119255685 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTCTCAGACTCCTACCTGG -3'
(R):5'- AGAGCCTAGAGACCTGACTG -3'

Sequencing Primer
(F):5'- AGACTCCTACCTGGGCCATG -3'
(R):5'- TAGAGACCTGACTGGCCTG -3'
Posted On2015-01-11