Incidental Mutation 'R3008:Cldn19'
ID 257435
Institutional Source Beutler Lab
Gene Symbol Cldn19
Ensembl Gene ENSMUSG00000066058
Gene Name claudin 19
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3008 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 119112638-119119635 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 119112987 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 73 (L73R)
Ref Sequence ENSEMBL: ENSMUSP00000092418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084309] [ENSMUST00000094823]
AlphaFold Q9ET38
Predicted Effect probably damaging
Transcript: ENSMUST00000084309
AA Change: L73R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081334
Gene: ENSMUSG00000066058
AA Change: L73R

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 182 5.8e-45 PFAM
Pfam:Claudin_2 15 184 1.1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094823
AA Change: L73R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092418
Gene: ENSMUSG00000066058
AA Change: L73R

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 182 6.1e-43 PFAM
Pfam:Claudin_2 15 184 2.6e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150252
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. siRNA knockdown of this gene in mice develops the FHHNC (familial hypomagnesemia with hypercalciuria and nephrocalcinosis) symptoms of chronic renal wasting of magnesium and calcium together with defective renal salt handling. The protein encoded by this gene interacts with another family member, Claudin 16, and their interaction is required for their assembly into tight junctions and for renal reabsorption of magnesium. This protein is a constituent of tight junctions in the Schwann cells of peripheral myelinated nerves and the gene deficiency affects the nerve conduction of peripheral myelinated fibers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a peripheral neuropathy associated with significant behavioral abnormalities, a complete lack of tight junctions from myelinated Schwann cells, and abnormal nerve conduction parameters of peripheral myelinated fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm2 T C 3: 59,652,930 (GRCm39) L123P possibly damaging Het
Acap3 T C 4: 155,990,139 (GRCm39) I773T probably benign Het
Atm A C 9: 53,392,050 (GRCm39) F1780V probably benign Het
Cers5 A G 15: 99,670,598 (GRCm39) probably benign Het
Cntnap5c A G 17: 58,666,204 (GRCm39) Y1078C probably damaging Het
Foxo6 A T 4: 120,125,961 (GRCm39) M278K probably benign Het
Gm10277 T A 11: 77,676,362 (GRCm39) probably benign Het
Gm4871 A T 5: 144,966,627 (GRCm39) D285E probably damaging Het
Gpd2 C T 2: 57,228,987 (GRCm39) R264* probably null Het
Ighv1-85 A T 12: 115,963,704 (GRCm39) Y99N probably damaging Het
Ighv7-1 A T 12: 113,860,071 (GRCm39) L107Q probably damaging Het
Kif17 A G 4: 138,005,476 (GRCm39) D347G probably damaging Het
Med22 T C 2: 26,798,396 (GRCm39) probably benign Het
Mme T A 3: 63,266,378 (GRCm39) N551K probably damaging Het
Mpp7 G A 18: 7,461,678 (GRCm39) P65L possibly damaging Het
Muc2 A T 7: 141,281,347 (GRCm39) H475L possibly damaging Het
Nfix CAAAAA CAAAA 8: 85,442,876 (GRCm39) probably null Het
Or8s10 G A 15: 98,335,857 (GRCm39) C169Y probably damaging Het
Pdp2 T A 8: 105,320,898 (GRCm39) I249N probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Slc26a9 G T 1: 131,693,652 (GRCm39) G714V probably damaging Het
Tarbp1 G A 8: 127,174,160 (GRCm39) T882I possibly damaging Het
Tex11 C A X: 99,977,021 (GRCm39) A487S possibly damaging Het
Ubr5 A G 15: 38,031,089 (GRCm39) S398P probably benign Het
Other mutations in Cldn19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02560:Cldn19 APN 4 119,112,921 (GRCm39) nonsense probably null
R1459:Cldn19 UTSW 4 119,112,810 (GRCm39) missense probably damaging 1.00
R1524:Cldn19 UTSW 4 119,114,248 (GRCm39) critical splice donor site probably null
R1828:Cldn19 UTSW 4 119,112,990 (GRCm39) missense probably benign 0.00
R3709:Cldn19 UTSW 4 119,114,094 (GRCm39) missense possibly damaging 0.70
R3877:Cldn19 UTSW 4 119,114,094 (GRCm39) missense possibly damaging 0.70
R4840:Cldn19 UTSW 4 119,112,951 (GRCm39) missense probably damaging 1.00
R5238:Cldn19 UTSW 4 119,112,930 (GRCm39) missense probably damaging 1.00
R5629:Cldn19 UTSW 4 119,114,116 (GRCm39) missense probably damaging 0.98
R7407:Cldn19 UTSW 4 119,112,882 (GRCm39) missense probably damaging 0.98
R9591:Cldn19 UTSW 4 119,114,357 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACTCTCAGACTCCTACCTGG -3'
(R):5'- AGAGCCTAGAGACCTGACTG -3'

Sequencing Primer
(F):5'- AGACTCCTACCTGGGCCATG -3'
(R):5'- TAGAGACCTGACTGGCCTG -3'
Posted On 2015-01-11