Incidental Mutation 'R3008:Pdp2'
ID257442
Institutional Source Beutler Lab
Gene Symbol Pdp2
Ensembl Gene ENSMUSG00000048371
Gene Namepyruvate dehyrogenase phosphatase catalytic subunit 2
Synonyms4833426J09Rik, LOC382051
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R3008 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location104591451-104599026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104594266 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 249 (I249N)
Ref Sequence ENSEMBL: ENSMUSP00000092821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059588]
Predicted Effect probably benign
Transcript: ENSMUST00000059588
AA Change: I249N

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000092821
Gene: ENSMUSG00000048371
AA Change: I249N

DomainStartEndE-ValueType
PP2Cc 96 518 1.1e-92 SMART
PP2C_SIG 121 520 2.56e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a mitochondrial protein that functions as a phosphatase and is involved in the enzymatic resetting of the pyruvate dehydrogenase complex. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 T C 4: 155,905,682 I773T probably benign Het
Atm A C 9: 53,480,750 F1780V probably benign Het
Cers5 A G 15: 99,772,717 probably benign Het
Cldn19 T G 4: 119,255,790 L73R probably damaging Het
Cntnap5c A G 17: 58,359,209 Y1078C probably damaging Het
Foxo6 A T 4: 120,268,764 M278K probably benign Het
Gm10277 T A 11: 77,785,536 probably benign Het
Gm4871 A T 5: 145,029,817 D285E probably damaging Het
Gm5538 T C 3: 59,745,509 L123P possibly damaging Het
Gpd2 C T 2: 57,338,975 R264* probably null Het
Ighv1-85 A T 12: 116,000,084 Y99N probably damaging Het
Ighv7-1 A T 12: 113,896,451 L107Q probably damaging Het
Kif17 A G 4: 138,278,165 D347G probably damaging Het
Med22 T C 2: 26,908,384 probably benign Het
Mme T A 3: 63,358,957 N551K probably damaging Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Muc2 A T 7: 141,695,104 H475L possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr282 G A 15: 98,437,976 C169Y probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Slc26a9 G T 1: 131,765,914 G714V probably damaging Het
Tarbp1 G A 8: 126,447,421 T882I possibly damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Ubr5 A G 15: 38,030,845 S398P probably benign Het
Other mutations in Pdp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Pdp2 APN 8 104594197 missense probably benign
IGL01771:Pdp2 APN 8 104594122 missense probably benign 0.06
IGL01946:Pdp2 APN 8 104594192 missense probably benign 0.00
IGL02313:Pdp2 APN 8 104594899 missense probably benign 0.44
IGL02588:Pdp2 APN 8 104594904 missense possibly damaging 0.73
IGL02981:Pdp2 APN 8 104593635 missense probably benign 0.00
R0456:Pdp2 UTSW 8 104593789 missense probably damaging 1.00
R1260:Pdp2 UTSW 8 104594617 missense probably damaging 0.96
R1974:Pdp2 UTSW 8 104593906 missense probably benign
R4580:Pdp2 UTSW 8 104594944 missense probably damaging 1.00
R4655:Pdp2 UTSW 8 104594536 missense probably benign 0.03
R5677:Pdp2 UTSW 8 104594688 missense probably damaging 1.00
R6813:Pdp2 UTSW 8 104594499 missense probably damaging 1.00
R8176:Pdp2 UTSW 8 104595055 missense probably damaging 1.00
R8472:Pdp2 UTSW 8 104594281 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGGAAAACATGAAGCCTTTGC -3'
(R):5'- CGTTGTGGTCACAGGTAAGAGG -3'

Sequencing Primer
(F):5'- ATCCTGCGTTGGCTCAAG -3'
(R):5'- GTAAACATGACCAGGCACCGTTTTC -3'
Posted On2015-01-11