Mutagenetix > Incidental Mutation

Incidental Mutation 'R0325:Shprh'

25745

Institutional Source

Beutler Lab

Gene Symbol

Shprh

Ensembl Gene

ENSMUSG00000090112

Gene Name

SNF2 histone linker PHD RING helicase

Synonyms

2610103K11Rik, D230017O13Rik

MMRRC Submission

038535-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0325 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

11149427-11217595 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 11170109 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 891 (M891I)

Ref Sequence

ENSEMBL: ENSMUSP00000125457 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541] [ENSMUST00000159810] [ENSMUST00000160461]

AlphaFold

Q7TPQ3

Predicted Effect

probably benign
Transcript: ENSMUST00000044053
AA Change: M891I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: M891I

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	3e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
low complexity region	1393	1404	N/A	INTRINSIC
RING	1423	1469	9.68e-3	SMART
Pfam:Helicase_C	1500	1613	1.6e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000054814
AA Change: M891I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112
AA Change: M891I

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	3e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
low complexity region	1393	1404	N/A	INTRINSIC
RING	1423	1469	9.68e-3	SMART
SCOP:d1fuka_	1504	1616	6e-8	SMART
Blast:HELICc	1533	1613	4e-46	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000159541
AA Change: M891I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112
AA Change: M891I

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	3e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
low complexity region	1393	1404	N/A	INTRINSIC
RING	1423	1469	9.68e-3	SMART
SCOP:d1fuka_	1504	1619	4e-8	SMART
Blast:HELICc	1533	1613	6e-46	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159553

Predicted Effect

probably benign
Transcript: ENSMUST00000159810
AA Change: M891I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000125457
Gene: ENSMUSG00000090112
AA Change: M891I

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	2e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
Blast:DEXDc	948	1026	2e-9	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000160461

SMART Domains

Protein: ENSMUSP00000125127
Gene: ENSMUSG00000090112

Domain	Start	End	E-Value	Type
PHD	131	178	2.33e-5	SMART

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.9%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	G	T	1: 26,685,266	Q278K	possibly damaging	Het
4933416C03Rik	T	C	10: 116,113,569	I17M	probably damaging	Het
5330417C22Rik	A	G	3: 108,461,251	L808P	probably damaging	Het
Adcyap1	A	G	17: 93,202,832	D96G	probably benign	Het
Adgrv1	C	T	13: 81,540,015	V1749M	probably damaging	Het
Adnp2	A	T	18: 80,130,653	N180K	probably benign	Het
Ahdc1	G	T	4: 133,062,719	A424S	unknown	Het
Alpk3	G	A	7: 81,067,953	R86H	possibly damaging	Het
Atf7ip	A	C	6: 136,560,989	T49P	possibly damaging	Het
Atp7b	G	A	8: 22,028,451	L124F	probably benign	Het
Bub1	A	T	2: 127,801,394	L1010*	probably null	Het
Cd300c	C	A	11: 114,959,585	E131*	probably null	Het
Cep135	A	G	5: 76,615,743	K527E	probably damaging	Het
Cfd	G	T	10: 79,891,758	E89*	probably null	Het
Crb1	A	C	1: 139,241,166	C871W	probably damaging	Het
D6Ertd527e	A	T	6: 87,111,295	S147C	unknown	Het
Ddx60	A	T	8: 61,983,855	E946D	probably benign	Het
Dmrt1	G	A	19: 25,546,007	E241K	probably benign	Het
Dnah11	C	G	12: 118,012,339	V2782L	probably benign	Het
Dzip1	T	C	14: 118,909,557	I313M	probably damaging	Het
Egln3	T	C	12: 54,203,512	E17G	probably benign	Het
Eif3d	A	G	15: 77,968,220	V42A	probably damaging	Het
Eogt	C	A	6: 97,113,955	G408W	probably damaging	Het
Fip1l1	T	A	5: 74,595,842	N498K	probably damaging	Het
Fmn2	T	A	1: 174,609,954		probably null	Het
Fndc3b	T	C	3: 27,467,430	E532G	probably damaging	Het
Gabrb3	T	C	7: 57,765,530	L116P	probably damaging	Het
Galnt6	A	T	15: 100,693,471		probably null	Het
Glmp	G	A	3: 88,325,084	M1I	probably null	Het
Gm13101	A	T	4: 143,966,740	V56E	probably damaging	Het
Gm13124	T	C	4: 144,555,511	Y237C	probably damaging	Het
Gm5478	T	C	15: 101,644,326	D79G	probably damaging	Het
Gnb1	T	G	4: 155,551,683	D153E	probably benign	Het
Grik2	T	C	10: 49,240,725	I86V	probably damaging	Het
Hdac3	C	T	18: 37,940,952		probably null	Het
Hdgfl2	G	A	17: 56,099,181	R523H	possibly damaging	Het
Ifngr1	T	A	10: 19,597,432	N43K	probably damaging	Het
Iqgap1	A	G	7: 80,751,930	W476R	probably benign	Het
Jag1	A	G	2: 137,095,445		probably null	Het
Kars	T	C	8: 112,008,216	D46G	probably benign	Het
Kcnd2	A	G	6: 21,216,683	I129V	probably damaging	Het
Lama3	A	C	18: 12,482,126	D1369A	probably damaging	Het
Lars	A	T	18: 42,250,902	V76E	possibly damaging	Het
Lgals9	T	C	11: 78,963,448	I337V	probably damaging	Het
Lrp1b	T	C	2: 40,851,711	D3068G	probably damaging	Het
Med12l	A	G	3: 59,077,059	T462A	possibly damaging	Het
Megf9	T	A	4: 70,455,941	D286V	probably damaging	Het
Meox1	T	A	11: 101,879,401	S167C	probably damaging	Het
Mier2	C	T	10: 79,542,596		probably null	Het
Mrps2	C	A	2: 28,469,779	T216K	probably damaging	Het
Mto1	A	T	9: 78,453,004	D258V	probably damaging	Het
Mug1	A	T	6: 121,849,842	H208L	probably benign	Het
Myo15b	T	A	11: 115,884,265	I751N	probably damaging	Het
Napg	C	T	18: 62,986,963	R149C	probably damaging	Het
Ndrg4	T	A	8: 95,710,935	M17K	probably damaging	Het
Nfrkb	T	G	9: 31,414,180	M973R	probably benign	Het
Nxph4	C	T	10: 127,526,911	R37H	probably damaging	Het
Oas1e	A	G	5: 120,795,395	I35T	probably damaging	Het
Oc90	C	T	15: 65,897,665		probably null	Het
Olfr1045	G	A	2: 86,198,711	L14F	possibly damaging	Het
Olfr1076	A	T	2: 86,509,205	T249S	probably benign	Het
Olfr1271	A	T	2: 90,265,536	M298K	probably null	Het
Olfr461	A	T	6: 40,544,123	N285K	possibly damaging	Het
Olfr653	A	T	7: 104,580,360	D238V	probably damaging	Het
Papola	T	A	12: 105,807,193	I157N	probably damaging	Het
Pcyox1l	G	C	18: 61,697,893	P303A	possibly damaging	Het
Pkdrej	T	C	15: 85,819,551	N728S	probably benign	Het
Pkp4	A	G	2: 59,318,529	D542G	probably damaging	Het
Pla2g5	C	T	4: 138,800,656	D100N	probably benign	Het
Poln	C	T	5: 34,149,764	R31H	probably benign	Het
Ppp3ca	G	A	3: 136,935,139	A484T	probably benign	Het
Prag1	A	G	8: 36,103,804	T514A	probably benign	Het
Prex2	G	A	1: 11,200,057		probably null	Het
Prrc2b	G	T	2: 32,199,091	W403L	probably damaging	Het
Pter	A	T	2: 13,000,937	K307M	probably damaging	Het
Ptpn5	G	A	7: 47,090,758	S99L	probably benign	Het
Ptpn5	A	C	7: 47,090,759	S99A	probably benign	Het
Rpap1	A	C	2: 119,771,840	H674Q	probably benign	Het
Rph3a	A	T	5: 120,943,064	D623E	probably benign	Het
Sdr9c7	G	T	10: 127,898,719	E25D	probably benign	Het
Sept9	T	G	11: 117,356,632	V479G	probably damaging	Het
Sgo2a	A	G	1: 58,016,697	D680G	probably benign	Het
Sgo2b	A	T	8: 63,928,376	I474N	probably benign	Het
Sgsm1	A	T	5: 113,288,835	I43N	probably damaging	Het
Skiv2l	A	T	17: 34,844,815	Y551N	possibly damaging	Het
Slc12a9	A	G	5: 137,322,846	M469T	probably damaging	Het
Slc4a2	A	T	5: 24,435,943	I747F	probably damaging	Het
Slc7a6	T	A	8: 106,194,517	N373K	probably damaging	Het
Slc7a6os	T	C	8: 106,201,056	D296G	probably benign	Het
Sncaip	A	G	18: 52,905,809	T120A	probably damaging	Het
Sorcs1	G	C	19: 50,313,042		probably null	Het
Spata16	A	G	3: 26,667,456	E42G	probably damaging	Het
Syne2	A	T	12: 75,962,641	M2440L	probably benign	Het
Tead2	A	G	7: 45,225,755	E232G	probably damaging	Het
Tmf1	T	G	6: 97,176,504	T203P	possibly damaging	Het
Trrap	C	A	5: 144,816,395	H1843Q	probably benign	Het
Unc79	C	A	12: 103,171,644	Q2314K	probably damaging	Het
Unc80	G	T	1: 66,510,881	G766V	probably damaging	Het
Vmn1r217	A	G	13: 23,114,594	L46P	probably damaging	Het
Vmn2r80	A	T	10: 79,148,939	I42F	possibly damaging	Het
Vwa5a	T	C	9: 38,728,665	V403A	probably damaging	Het
Zfp42	T	C	8: 43,295,951	E171G	probably damaging	Het
Zfp64	A	T	2: 168,926,040	S551T	probably benign	Het

Other mutations in Shprh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Shprh	APN	10	11188158	missense	probably damaging	1.00
IGL00583:Shprh	APN	10	11188020	missense	probably benign	0.37
IGL00684:Shprh	APN	10	11163037	missense	probably benign	0.11
IGL01295:Shprh	APN	10	11183868	missense	probably damaging	0.96
IGL01387:Shprh	APN	10	11170254	missense	probably damaging	1.00
IGL01635:Shprh	APN	10	11170019	nonsense	probably null
IGL01833:Shprh	APN	10	11191062	missense	probably damaging	1.00
IGL02013:Shprh	APN	10	11181502	splice site	probably benign
IGL02502:Shprh	APN	10	11194357	missense	possibly damaging	0.66
IGL02819:Shprh	APN	10	11154765	missense	possibly damaging	0.93
PIT4581001:Shprh	UTSW	10	11192494	frame shift	probably null
R0010:Shprh	UTSW	10	11151931	missense	probably benign
R0010:Shprh	UTSW	10	11151931	missense	probably benign
R0053:Shprh	UTSW	10	11194372	splice site	probably null
R0053:Shprh	UTSW	10	11194372	splice site	probably null
R0255:Shprh	UTSW	10	11186391	missense	possibly damaging	0.92
R0331:Shprh	UTSW	10	11194170	splice site	probably benign
R0494:Shprh	UTSW	10	11157191	missense	probably damaging	1.00
R0532:Shprh	UTSW	10	11162812	missense	possibly damaging	0.90
R0546:Shprh	UTSW	10	11183887	splice site	probably benign
R0574:Shprh	UTSW	10	11163077	unclassified	probably benign
R0605:Shprh	UTSW	10	11207112	missense	probably damaging	1.00
R0662:Shprh	UTSW	10	11186847	missense	probably damaging	1.00
R1148:Shprh	UTSW	10	11213482	missense	possibly damaging	0.95
R1148:Shprh	UTSW	10	11213482	missense	possibly damaging	0.95
R1263:Shprh	UTSW	10	11159530	missense	probably damaging	1.00
R1588:Shprh	UTSW	10	11164744	missense	probably damaging	1.00
R1638:Shprh	UTSW	10	11157078	missense	probably benign
R1830:Shprh	UTSW	10	11186911	splice site	probably null
R1898:Shprh	UTSW	10	11186869	missense	probably damaging	1.00
R1903:Shprh	UTSW	10	11183797	nonsense	probably null
R2060:Shprh	UTSW	10	11152120	missense	probably benign	0.03
R2225:Shprh	UTSW	10	11162235	unclassified	probably benign
R2363:Shprh	UTSW	10	11171953	missense	probably damaging	1.00
R2509:Shprh	UTSW	10	11166724	missense	probably damaging	1.00
R2891:Shprh	UTSW	10	11164356	missense	probably damaging	1.00
R3077:Shprh	UTSW	10	11170413	missense	probably damaging	1.00
R3150:Shprh	UTSW	10	11170030	missense	probably damaging	0.97
R3796:Shprh	UTSW	10	11178757	missense	possibly damaging	0.89
R4196:Shprh	UTSW	10	11207860	utr 3 prime	probably benign
R4423:Shprh	UTSW	10	11186518	missense	possibly damaging	0.82
R4488:Shprh	UTSW	10	11160471	missense	probably benign	0.17
R4748:Shprh	UTSW	10	11170476	missense	probably damaging	1.00
R4768:Shprh	UTSW	10	11181540	missense	probably damaging	0.96
R4867:Shprh	UTSW	10	11164557	missense	probably benign	0.00
R4937:Shprh	UTSW	10	11157119	missense	probably benign
R5140:Shprh	UTSW	10	11154705	missense	probably benign	0.03
R5318:Shprh	UTSW	10	11166557	missense	probably benign	0.04
R5323:Shprh	UTSW	10	11170297	splice site	probably null
R5450:Shprh	UTSW	10	11212330	missense	possibly damaging	0.70
R5872:Shprh	UTSW	10	11188073	missense	probably damaging	1.00
R6030:Shprh	UTSW	10	11151991	missense	probably benign	0.37
R6030:Shprh	UTSW	10	11151991	missense	probably benign	0.37
R6392:Shprh	UTSW	10	11178741	nonsense	probably null
R6416:Shprh	UTSW	10	11167873	missense	probably damaging	1.00
R6470:Shprh	UTSW	10	11171937	missense	probably damaging	0.98
R6513:Shprh	UTSW	10	11186893	missense	probably damaging	1.00
R6530:Shprh	UTSW	10	11194267	missense	probably benign	0.02
R6678:Shprh	UTSW	10	11166545	missense	probably benign	0.16
R6757:Shprh	UTSW	10	11181508	splice site	probably null
R6971:Shprh	UTSW	10	11166693	missense	probably damaging	1.00
R7158:Shprh	UTSW	10	11166730	missense	probably damaging	0.98
R7582:Shprh	UTSW	10	11164705	missense	probably benign
R7757:Shprh	UTSW	10	11162180	missense	probably benign	0.30
R7812:Shprh	UTSW	10	11151991	missense	probably benign
R7998:Shprh	UTSW	10	11185341	missense	probably damaging	1.00
R8061:Shprh	UTSW	10	11212333	missense	possibly damaging	0.71
R8082:Shprh	UTSW	10	11151811	missense	probably benign	0.22
R8116:Shprh	UTSW	10	11213461	missense	probably damaging	0.99
R8390:Shprh	UTSW	10	11187983	missense	possibly damaging	0.92
R8445:Shprh	UTSW	10	11181569	missense	possibly damaging	0.92
R8530:Shprh	UTSW	10	11151934	missense	probably benign	0.37
R8759:Shprh	UTSW	10	11157164	missense	possibly damaging	0.92
R8937:Shprh	UTSW	10	11185437	missense	possibly damaging	0.60
R8995:Shprh	UTSW	10	11164830	nonsense	probably null
R9053:Shprh	UTSW	10	11154702	missense	probably benign	0.04
R9131:Shprh	UTSW	10	11162845	missense	possibly damaging	0.58
R9176:Shprh	UTSW	10	11160576	missense	probably benign	0.02
R9391:Shprh	UTSW	10	11162889	missense	probably benign	0.05
R9423:Shprh	UTSW	10	11205263	missense	probably damaging	1.00
R9563:Shprh	UTSW	10	11166491	nonsense	probably null
R9668:Shprh	UTSW	10	11206332	missense	probably damaging	0.97
R9709:Shprh	UTSW	10	11162830	missense	possibly damaging	0.91
R9718:Shprh	UTSW	10	11213504	missense	probably damaging	1.00
R9750:Shprh	UTSW	10	11164460	missense	probably damaging	0.98
RF012:Shprh	UTSW	10	11164841	missense	probably benign	0.02
V8831:Shprh	UTSW	10	11186862	missense	probably damaging	1.00
Z1176:Shprh	UTSW	10	11164553	missense	probably benign
Z1176:Shprh	UTSW	10	11186447	missense	probably damaging	1.00
Z1177:Shprh	UTSW	10	11151762	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AACATTTAGCCCTGTGTCCTGTGAC -3'
(R):5'- CCTGAGCTTCACTATGGCATCCTG -3'

Sequencing Primer
(F):5'- GACTTTTCCTTTACAGATCTTTTTGG -3'
(R):5'- GCGGTGATAGAAATGCCTCTC -3'

Posted On

2013-04-16