Incidental Mutation 'R3008:Mpp7'
ID 257451
Institutional Source Beutler Lab
Gene Symbol Mpp7
Ensembl Gene ENSMUSG00000057440
Gene Name membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
Synonyms 2810038M04Rik, LOC381166, 5430426E14Rik, 1110068J02Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.145) question?
Stock # R3008 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 7347959-7626866 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 7461678 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 65 (P65L)
Ref Sequence ENSEMBL: ENSMUSP00000111535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115869]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000115869
AA Change: P65L

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111535
Gene: ENSMUSG00000057440
AA Change: P65L

DomainStartEndE-ValueType
L27 10 68 7.05e-14 SMART
L27 72 125 3.72e-13 SMART
PDZ 147 220 3.8e-15 SMART
SH3 231 297 1.4e-11 SMART
low complexity region 317 328 N/A INTRINSIC
GuKc 367 563 4.01e-65 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the p55 Stardust family of membrane-associated guanylate kinase (MAGUK) proteins, which function in the establishment of epithelial cell polarity. This family member forms a complex with the polarity protein DLG1 (discs, large homolog 1) and facilitates epithelial cell polarity and tight junction formation. Polymorphisms in this gene are associated with variations in site-specific bone mineral density (BMD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm2 T C 3: 59,652,930 (GRCm39) L123P possibly damaging Het
Acap3 T C 4: 155,990,139 (GRCm39) I773T probably benign Het
Atm A C 9: 53,392,050 (GRCm39) F1780V probably benign Het
Cers5 A G 15: 99,670,598 (GRCm39) probably benign Het
Cldn19 T G 4: 119,112,987 (GRCm39) L73R probably damaging Het
Cntnap5c A G 17: 58,666,204 (GRCm39) Y1078C probably damaging Het
Foxo6 A T 4: 120,125,961 (GRCm39) M278K probably benign Het
Gm10277 T A 11: 77,676,362 (GRCm39) probably benign Het
Gm4871 A T 5: 144,966,627 (GRCm39) D285E probably damaging Het
Gpd2 C T 2: 57,228,987 (GRCm39) R264* probably null Het
Ighv1-85 A T 12: 115,963,704 (GRCm39) Y99N probably damaging Het
Ighv7-1 A T 12: 113,860,071 (GRCm39) L107Q probably damaging Het
Kif17 A G 4: 138,005,476 (GRCm39) D347G probably damaging Het
Med22 T C 2: 26,798,396 (GRCm39) probably benign Het
Mme T A 3: 63,266,378 (GRCm39) N551K probably damaging Het
Muc2 A T 7: 141,281,347 (GRCm39) H475L possibly damaging Het
Nfix CAAAAA CAAAA 8: 85,442,876 (GRCm39) probably null Het
Or8s10 G A 15: 98,335,857 (GRCm39) C169Y probably damaging Het
Pdp2 T A 8: 105,320,898 (GRCm39) I249N probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Slc26a9 G T 1: 131,693,652 (GRCm39) G714V probably damaging Het
Tarbp1 G A 8: 127,174,160 (GRCm39) T882I possibly damaging Het
Tex11 C A X: 99,977,021 (GRCm39) A487S possibly damaging Het
Ubr5 A G 15: 38,031,089 (GRCm39) S398P probably benign Het
Other mutations in Mpp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Mpp7 APN 18 7,353,297 (GRCm39) missense probably benign 0.00
IGL01575:Mpp7 APN 18 7,403,365 (GRCm39) splice site probably benign
IGL02973:Mpp7 APN 18 7,403,297 (GRCm39) missense probably damaging 1.00
IGL02985:Mpp7 APN 18 7,461,637 (GRCm39) critical splice donor site probably null
IGL03224:Mpp7 APN 18 7,403,269 (GRCm39) missense probably benign 0.28
IGL03248:Mpp7 APN 18 7,403,269 (GRCm39) missense probably benign 0.28
R0040:Mpp7 UTSW 18 7,403,180 (GRCm39) splice site probably benign
R0089:Mpp7 UTSW 18 7,439,555 (GRCm39) splice site probably benign
R1413:Mpp7 UTSW 18 7,350,977 (GRCm39) missense probably damaging 1.00
R1634:Mpp7 UTSW 18 7,350,984 (GRCm39) missense possibly damaging 0.63
R1859:Mpp7 UTSW 18 7,350,967 (GRCm39) makesense probably null
R2379:Mpp7 UTSW 18 7,403,345 (GRCm39) nonsense probably null
R2869:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R2869:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R2871:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R2871:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R3009:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R3010:Mpp7 UTSW 18 7,461,678 (GRCm39) missense possibly damaging 0.76
R3782:Mpp7 UTSW 18 7,351,085 (GRCm39) missense probably damaging 0.99
R3980:Mpp7 UTSW 18 7,444,062 (GRCm39) missense probably benign 0.23
R4574:Mpp7 UTSW 18 7,353,228 (GRCm39) missense probably benign 0.02
R4772:Mpp7 UTSW 18 7,379,983 (GRCm39) splice site probably null
R5066:Mpp7 UTSW 18 7,513,002 (GRCm39) missense possibly damaging 0.95
R5437:Mpp7 UTSW 18 7,458,930 (GRCm39) critical splice donor site probably null
R5451:Mpp7 UTSW 18 7,442,855 (GRCm39) missense probably null 0.95
R5578:Mpp7 UTSW 18 7,355,101 (GRCm39) missense probably benign
R5651:Mpp7 UTSW 18 7,355,016 (GRCm39) critical splice donor site probably null
R5787:Mpp7 UTSW 18 7,461,682 (GRCm39) missense probably benign
R6979:Mpp7 UTSW 18 7,355,049 (GRCm39) missense possibly damaging 0.64
R6984:Mpp7 UTSW 18 7,441,623 (GRCm39) missense probably damaging 1.00
R7448:Mpp7 UTSW 18 7,351,079 (GRCm39) missense probably damaging 0.98
R7517:Mpp7 UTSW 18 7,440,183 (GRCm39) nonsense probably null
R8278:Mpp7 UTSW 18 7,444,025 (GRCm39) missense probably benign
R8373:Mpp7 UTSW 18 7,444,096 (GRCm39) missense probably damaging 1.00
R8676:Mpp7 UTSW 18 7,440,430 (GRCm39) critical splice donor site probably null
R9206:Mpp7 UTSW 18 7,403,327 (GRCm39) missense probably benign 0.12
R9208:Mpp7 UTSW 18 7,403,327 (GRCm39) missense probably benign 0.12
R9439:Mpp7 UTSW 18 7,461,692 (GRCm39) nonsense probably null
R9790:Mpp7 UTSW 18 7,355,049 (GRCm39) missense probably benign 0.07
R9791:Mpp7 UTSW 18 7,355,049 (GRCm39) missense probably benign 0.07
X0028:Mpp7 UTSW 18 7,403,273 (GRCm39) missense probably benign 0.04
Z1177:Mpp7 UTSW 18 7,355,062 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACAAGCGTGGTGATGACAG -3'
(R):5'- TGTTCTGTCTGAAGAAAGTTTTGCC -3'

Sequencing Primer
(F):5'- CAGAGATTTGGGAAACATTTGCAAC -3'
(R):5'- GGATTGCATATACATGTCTGCC -3'
Posted On 2015-01-11