Incidental Mutation 'R3009:Gprc6a'
ID 257461
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene Name G protein-coupled receptor, family C, group 6, member A
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3009 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 51490919-51507554 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 51504392 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 151 (T151A)
Ref Sequence ENSEMBL: ENSMUSP00000151341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
AlphaFold Q8K4Z6
Predicted Effect probably benign
Transcript: ENSMUST00000020062
AA Change: T151A

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: T151A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218684
AA Change: T151A

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000219286
AA Change: T151A

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap12 A G 10: 4,307,891 (GRCm39) D1567G probably benign Het
Bmp3 T C 5: 99,027,696 (GRCm39) S439P probably damaging Het
Btnl2 C T 17: 34,582,492 (GRCm39) R353C probably damaging Het
Galc T C 12: 98,170,228 (GRCm39) D676G probably damaging Het
Gpd2 C T 2: 57,228,987 (GRCm39) R264* probably null Het
Limk2 A G 11: 3,309,046 (GRCm39) I104T probably benign Het
Mei1 A G 15: 81,996,726 (GRCm39) H585R probably damaging Het
Mpp7 G A 18: 7,461,678 (GRCm39) P65L possibly damaging Het
Mtfr1 A T 3: 19,269,750 (GRCm39) T133S probably benign Het
Or12k8 T C 2: 36,975,089 (GRCm39) I224V probably benign Het
Or5h22 A G 16: 58,895,350 (GRCm39) V31A probably benign Het
Or6b13 T C 7: 139,782,669 (GRCm39) R5G probably benign Het
Or8k35 T C 2: 86,424,714 (GRCm39) T153A probably benign Het
Prkg1 G A 19: 31,641,512 (GRCm39) T57I possibly damaging Het
Sppl2c C T 11: 104,078,141 (GRCm39) P314S probably benign Het
Tex11 C A X: 99,977,021 (GRCm39) A487S possibly damaging Het
Urb1 A G 16: 90,571,686 (GRCm39) I1041T probably benign Het
Vmn2r72 A T 7: 85,398,850 (GRCm39) M501K probably benign Het
Vmn2r91 G A 17: 18,325,717 (GRCm39) V112I probably benign Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51,491,526 (GRCm39) missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51,503,180 (GRCm39) missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51,502,819 (GRCm39) missense probably benign
IGL02317:Gprc6a APN 10 51,497,049 (GRCm39) missense probably benign 0.01
IGL02995:Gprc6a APN 10 51,502,895 (GRCm39) missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51,492,699 (GRCm39) missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51,504,445 (GRCm39) missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51,491,968 (GRCm39) missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51,491,355 (GRCm39) missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51,504,533 (GRCm39) missense probably benign 0.01
R1831:Gprc6a UTSW 10 51,491,902 (GRCm39) missense probably benign 0.22
R2108:Gprc6a UTSW 10 51,491,304 (GRCm39) missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2160:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2162:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2229:Gprc6a UTSW 10 51,502,891 (GRCm39) missense possibly damaging 0.50
R3709:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3710:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3737:Gprc6a UTSW 10 51,503,007 (GRCm39) missense probably benign
R3914:Gprc6a UTSW 10 51,504,371 (GRCm39) missense probably benign 0.00
R3918:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3964:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3965:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3966:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3973:Gprc6a UTSW 10 51,504,544 (GRCm39) missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3978:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3979:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R4306:Gprc6a UTSW 10 51,492,735 (GRCm39) missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4405:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4408:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4713:Gprc6a UTSW 10 51,507,553 (GRCm39) unclassified probably benign
R4788:Gprc6a UTSW 10 51,491,104 (GRCm39) missense probably benign 0.00
R5248:Gprc6a UTSW 10 51,491,089 (GRCm39) missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51,502,900 (GRCm39) missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51,502,798 (GRCm39) missense probably benign
R5721:Gprc6a UTSW 10 51,491,076 (GRCm39) missense probably benign 0.06
R6061:Gprc6a UTSW 10 51,491,907 (GRCm39) missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51,491,173 (GRCm39) missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51,491,356 (GRCm39) missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51,491,008 (GRCm39) missense probably benign 0.44
R6207:Gprc6a UTSW 10 51,502,931 (GRCm39) missense probably benign 0.36
R6497:Gprc6a UTSW 10 51,491,797 (GRCm39) missense probably benign 0.05
R6717:Gprc6a UTSW 10 51,491,233 (GRCm39) missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51,507,412 (GRCm39) missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51,502,841 (GRCm39) nonsense probably null
R7000:Gprc6a UTSW 10 51,491,143 (GRCm39) missense probably benign 0.34
R7019:Gprc6a UTSW 10 51,507,508 (GRCm39) missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51,490,986 (GRCm39) missense probably benign
R7173:Gprc6a UTSW 10 51,504,595 (GRCm39) missense probably benign 0.01
R7579:Gprc6a UTSW 10 51,502,883 (GRCm39) missense probably benign
R7736:Gprc6a UTSW 10 51,491,549 (GRCm39) missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51,491,026 (GRCm39) missense probably benign 0.02
R8273:Gprc6a UTSW 10 51,507,370 (GRCm39) missense probably benign
R8329:Gprc6a UTSW 10 51,503,355 (GRCm39) nonsense probably null
R8517:Gprc6a UTSW 10 51,507,337 (GRCm39) missense probably benign 0.00
R8723:Gprc6a UTSW 10 51,491,518 (GRCm39) missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51,497,079 (GRCm39) missense probably benign 0.00
R8829:Gprc6a UTSW 10 51,491,295 (GRCm39) missense probably damaging 0.99
R9151:Gprc6a UTSW 10 51,497,182 (GRCm39) missense possibly damaging 0.94
R9420:Gprc6a UTSW 10 51,491,506 (GRCm39) missense probably damaging 0.99
R9753:Gprc6a UTSW 10 51,504,364 (GRCm39) missense probably benign 0.20
R9766:Gprc6a UTSW 10 51,491,884 (GRCm39) missense probably damaging 1.00
R9790:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
R9791:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
Z1177:Gprc6a UTSW 10 51,491,305 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTAATAGCAAATGTGATGGATAGACC -3'
(R):5'- CGGAGTCAAGCTGGGATATG -3'

Sequencing Primer
(F):5'- GGGGAATCATACGGTCTCATACC -3'
(R):5'- GCTGGGATATGAAATCTATGACAC -3'
Posted On 2015-01-11