Incidental Mutation 'R3010:Ptpn1'
ID 257476
Institutional Source Beutler Lab
Gene Symbol Ptpn1
Ensembl Gene ENSMUSG00000027540
Gene Name protein tyrosine phosphatase, non-receptor type 1
Synonyms PTP1B, PTP-1B
Accession Numbers
Essential gene? Probably essential (E-score: 0.916) question?
Stock # R3010 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 167773977-167821305 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 167816742 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 266 (Q266K)
Ref Sequence ENSEMBL: ENSMUSP00000029053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029053]
AlphaFold P35821
Predicted Effect probably damaging
Transcript: ENSMUST00000029053
AA Change: Q266K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029053
Gene: ENSMUSG00000027540
AA Change: Q266K

DomainStartEndE-ValueType
PTPc 15 279 1.35e-123 SMART
low complexity region 301 320 N/A INTRINSIC
low complexity region 354 364 N/A INTRINSIC
low complexity region 387 397 N/A INTRINSIC
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147210
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the founding member of the protein tyrosine phosphatase (PTP) family, which was isolated and identified based on its enzymatic activity and amino acid sequence. PTPs catalyze the hydrolysis of the phosphate monoesters specifically on tyrosine residues. Members of the PTP family share a highly conserved catalytic motif, which is essential for the catalytic activity. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP has been shown to act as a negative regulator of insulin signaling by dephosphorylating the phosphotryosine residues of insulin receptor kinase. This PTP was also reported to dephosphorylate epidermal growth factor receptor kinase, as well as JAK2 and TYK2 kinases, which implicated the role of this PTP in cell growth control, and cell response to interferon stimulation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit greatly reduced adiposity due to reduced fat cell mass, increased basal metabolic rate, mild hypoglycemia and hypoinsulinemia, increased insulin sensitivity, and enhanced sensitivity to leptin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Armc8 T C 9: 99,369,966 (GRCm39) E591G probably benign Het
Cers5 A G 15: 99,670,598 (GRCm39) probably benign Het
Cgrrf1 T C 14: 47,091,223 (GRCm39) V249A probably benign Het
Kctd1 T C 18: 15,107,143 (GRCm39) E178G probably damaging Het
Mpp7 G A 18: 7,461,678 (GRCm39) P65L possibly damaging Het
Mx2 T C 16: 97,347,999 (GRCm39) V208A possibly damaging Het
Pacs2 T C 12: 113,024,700 (GRCm39) S427P probably benign Het
Pdzrn4 A G 15: 92,667,692 (GRCm39) I615V probably benign Het
Snx18 G A 13: 113,753,422 (GRCm39) Q504* probably null Het
Sppl2c C T 11: 104,078,141 (GRCm39) P314S probably benign Het
Tbx15 A G 3: 99,161,209 (GRCm39) probably benign Het
Tdrd6 G A 17: 43,938,933 (GRCm39) T705I probably benign Het
Tex11 C A X: 99,977,021 (GRCm39) A487S possibly damaging Het
Vmn2r113 T C 17: 23,177,105 (GRCm39) S630P probably damaging Het
Zdbf2 T A 1: 63,342,224 (GRCm39) V201D possibly damaging Het
Zer1 A G 2: 30,003,297 (GRCm39) I40T probably benign Het
Other mutations in Ptpn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Ptpn1 APN 2 167,809,712 (GRCm39) missense probably damaging 1.00
IGL02976:Ptpn1 APN 2 167,813,704 (GRCm39) missense probably benign 0.01
escondido UTSW 2 167,816,161 (GRCm39) missense probably damaging 1.00
R0106:Ptpn1 UTSW 2 167,818,338 (GRCm39) unclassified probably benign
R0106:Ptpn1 UTSW 2 167,818,338 (GRCm39) unclassified probably benign
R1438:Ptpn1 UTSW 2 167,818,529 (GRCm39) missense probably damaging 0.99
R3607:Ptpn1 UTSW 2 167,817,427 (GRCm39) missense probably benign
R3755:Ptpn1 UTSW 2 167,816,143 (GRCm39) missense probably damaging 1.00
R4075:Ptpn1 UTSW 2 167,818,433 (GRCm39) splice site probably null
R4160:Ptpn1 UTSW 2 167,809,731 (GRCm39) missense probably benign 0.04
R4627:Ptpn1 UTSW 2 167,809,701 (GRCm39) missense probably benign 0.00
R4754:Ptpn1 UTSW 2 167,816,080 (GRCm39) missense probably damaging 1.00
R5596:Ptpn1 UTSW 2 167,816,683 (GRCm39) missense probably damaging 1.00
R5920:Ptpn1 UTSW 2 167,813,668 (GRCm39) missense probably benign 0.02
R6133:Ptpn1 UTSW 2 167,809,716 (GRCm39) missense possibly damaging 0.94
R7296:Ptpn1 UTSW 2 167,816,692 (GRCm39) missense probably damaging 0.98
R8350:Ptpn1 UTSW 2 167,816,161 (GRCm39) missense probably damaging 1.00
R9275:Ptpn1 UTSW 2 167,816,176 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AACCGGTCCCAAGTTTGCTG -3'
(R):5'- TGACCTCAACAGTATTGGACC -3'

Sequencing Primer
(F):5'- GTCCCAAGTTTGCTGCATTTTTG -3'
(R):5'- TGAGTTTCTTTCACAGAGTAGAGTC -3'
Posted On 2015-01-11