Mutagenetix > Incidental Mutation

Incidental Mutation 'R3010:Tbx15'

257477

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

Tbx8, de, Tbx14

Accession Numbers

Essential gene?

Probably essential (E-score: 0.930) question?

Stock #

R3010 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

99147697-99261575 bp(+) (GRCm39)

Type of Mutation

intron

DNA Base Change (assembly)

A to G at 99161209 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000143417 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000151606]

AlphaFold

O70306

Predicted Effect

unknown
Transcript: ENSMUST00000029462
AA Change: R5G

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: R5G

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000151606

SMART Domains

Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868

Domain	Start	End	E-Value	Type
Pfam:T-box	8	51	1.1e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196228

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 16 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Armc8	T	C	9: 99,369,966 (GRCm39)	E591G	probably benign	Het
Cers5	A	G	15: 99,670,598 (GRCm39)		probably benign	Het
Cgrrf1	T	C	14: 47,091,223 (GRCm39)	V249A	probably benign	Het
Kctd1	T	C	18: 15,107,143 (GRCm39)	E178G	probably damaging	Het
Mpp7	G	A	18: 7,461,678 (GRCm39)	P65L	possibly damaging	Het
Mx2	T	C	16: 97,347,999 (GRCm39)	V208A	possibly damaging	Het
Pacs2	T	C	12: 113,024,700 (GRCm39)	S427P	probably benign	Het
Pdzrn4	A	G	15: 92,667,692 (GRCm39)	I615V	probably benign	Het
Ptpn1	C	A	2: 167,816,742 (GRCm39)	Q266K	probably damaging	Het
Snx18	G	A	13: 113,753,422 (GRCm39)	Q504*	probably null	Het
Sppl2c	C	T	11: 104,078,141 (GRCm39)	P314S	probably benign	Het
Tdrd6	G	A	17: 43,938,933 (GRCm39)	T705I	probably benign	Het
Tex11	C	A	X: 99,977,021 (GRCm39)	A487S	possibly damaging	Het
Vmn2r113	T	C	17: 23,177,105 (GRCm39)	S630P	probably damaging	Het
Zdbf2	T	A	1: 63,342,224 (GRCm39)	V201D	possibly damaging	Het
Zer1	A	G	2: 30,003,297 (GRCm39)	I40T	probably benign	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99,223,562 (GRCm39)	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99,223,544 (GRCm39)	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99,220,358 (GRCm39)	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99,259,800 (GRCm39)	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99,259,826 (GRCm39)	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99,259,514 (GRCm39)	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99,259,296 (GRCm39)	missense	probably benign	0.00
shin_guard	UTSW	3	99,259,508 (GRCm39)	missense	possibly damaging	0.90
Shortcut	UTSW	3	99,220,389 (GRCm39)	nonsense	probably null
R0012:Tbx15	UTSW	3	99,259,412 (GRCm39)	missense	probably benign
R0109:Tbx15	UTSW	3	99,259,182 (GRCm39)	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99,259,707 (GRCm39)	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99,223,634 (GRCm39)	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99,223,639 (GRCm39)	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99,259,427 (GRCm39)	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99,259,427 (GRCm39)	missense	possibly damaging	0.92
R1506:Tbx15	UTSW	3	99,259,228 (GRCm39)	missense	possibly damaging	0.80
R1681:Tbx15	UTSW	3	99,259,140 (GRCm39)	splice site	probably null
R1762:Tbx15	UTSW	3	99,259,260 (GRCm39)	nonsense	probably null
R1789:Tbx15	UTSW	3	99,259,562 (GRCm39)	nonsense	probably null
R2167:Tbx15	UTSW	3	99,233,771 (GRCm39)	splice site	probably benign
R2254:Tbx15	UTSW	3	99,259,190 (GRCm39)	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99,223,672 (GRCm39)	splice site	probably null
R2441:Tbx15	UTSW	3	99,259,827 (GRCm39)	missense	probably damaging	0.99
R3118:Tbx15	UTSW	3	99,259,470 (GRCm39)	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99,220,370 (GRCm39)	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99,259,683 (GRCm39)	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99,259,583 (GRCm39)	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99,233,700 (GRCm39)	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99,161,390 (GRCm39)	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99,223,649 (GRCm39)	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99,259,362 (GRCm39)	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99,223,600 (GRCm39)	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99,259,508 (GRCm39)	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99,259,880 (GRCm39)	missense	probably benign
R5690:Tbx15	UTSW	3	99,216,166 (GRCm39)	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99,220,402 (GRCm39)	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99,259,833 (GRCm39)	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99,259,833 (GRCm39)	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99,220,431 (GRCm39)	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99,161,203 (GRCm39)	nonsense	probably null
R6596:Tbx15	UTSW	3	99,259,508 (GRCm39)	missense	probably benign
R6680:Tbx15	UTSW	3	99,220,389 (GRCm39)	nonsense	probably null
R6931:Tbx15	UTSW	3	99,259,467 (GRCm39)	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99,161,254 (GRCm39)	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99,259,886 (GRCm39)	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99,259,305 (GRCm39)	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99,220,376 (GRCm39)	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99,222,219 (GRCm39)	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99,222,085 (GRCm39)	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99,233,708 (GRCm39)	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99,259,647 (GRCm39)	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99,222,151 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGCAGAGTTTGTGAGCGC -3'
(R):5'- AGGCTCAAGGTATTTATGCCAAG -3'

Sequencing Primer
(F):5'- AGCTGGACTCAGTGCTCCATG -3'
(R):5'- GTATTTATGCCAAGAAAAAGGAACCC -3'

Posted On

2015-01-11