Incidental Mutation 'R3010:Tbx15'
ID 257477
Institutional Source Beutler Lab
Gene Symbol Tbx15
Ensembl Gene ENSMUSG00000027868
Gene Name T-box 15
Synonyms de, Tbx14, Tbx8
Accession Numbers
Essential gene? Probably essential (E-score: 0.936) question?
Stock # R3010 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 99240381-99354259 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) A to G at 99253893 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029462] [ENSMUST00000151606]
AlphaFold O70306
Predicted Effect unknown
Transcript: ENSMUST00000029462
AA Change: R5G
SMART Domains Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: R5G

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
TBOX 112 309 8.05e-131 SMART
Blast:TBOX 310 482 8e-83 BLAST
low complexity region 486 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151606
SMART Domains Protein: ENSMUSP00000143417
Gene: ENSMUSG00000027868

DomainStartEndE-ValueType
Pfam:T-box 8 51 1.1e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196228
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Armc8 T C 9: 99,487,913 E591G probably benign Het
Cers5 A G 15: 99,772,717 probably benign Het
Cgrrf1 T C 14: 46,853,766 V249A probably benign Het
Kctd1 T C 18: 14,974,086 E178G probably damaging Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Mx2 T C 16: 97,546,799 V208A possibly damaging Het
Pacs2 T C 12: 113,061,080 S427P probably benign Het
Pdzrn4 A G 15: 92,769,811 I615V probably benign Het
Ptpn1 C A 2: 167,974,822 Q266K probably damaging Het
Snx18 G A 13: 113,616,886 Q504* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
Tdrd6 G A 17: 43,628,042 T705I probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Vmn2r113 T C 17: 22,958,131 S630P probably damaging Het
Zdbf2 T A 1: 63,303,065 V201D possibly damaging Het
Zer1 A G 2: 30,113,285 I40T probably benign Het
Other mutations in Tbx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Tbx15 APN 3 99316246 missense probably damaging 1.00
IGL01458:Tbx15 APN 3 99316228 missense probably damaging 0.98
IGL01633:Tbx15 APN 3 99313042 missense probably damaging 0.97
IGL02338:Tbx15 APN 3 99352484 missense probably damaging 1.00
IGL02415:Tbx15 APN 3 99352510 missense probably benign 0.01
IGL03143:Tbx15 APN 3 99352198 missense possibly damaging 0.67
IGL03201:Tbx15 APN 3 99351980 missense probably benign 0.00
shin_guard UTSW 3 99352192 missense possibly damaging 0.90
Shortcut UTSW 3 99313073 nonsense probably null
R0012:Tbx15 UTSW 3 99352096 missense probably benign
R0109:Tbx15 UTSW 3 99351866 missense possibly damaging 0.92
R0277:Tbx15 UTSW 3 99352391 missense probably damaging 1.00
R0462:Tbx15 UTSW 3 99316318 missense probably damaging 1.00
R1134:Tbx15 UTSW 3 99316323 missense probably damaging 0.98
R1347:Tbx15 UTSW 3 99352111 missense possibly damaging 0.92
R1347:Tbx15 UTSW 3 99352111 missense possibly damaging 0.92
R1506:Tbx15 UTSW 3 99351912 missense possibly damaging 0.80
R1681:Tbx15 UTSW 3 99351824 splice site probably null
R1762:Tbx15 UTSW 3 99351944 nonsense probably null
R1789:Tbx15 UTSW 3 99352246 nonsense probably null
R2167:Tbx15 UTSW 3 99326455 splice site probably benign
R2254:Tbx15 UTSW 3 99351874 missense possibly damaging 0.52
R2357:Tbx15 UTSW 3 99316356 splice site probably null
R2441:Tbx15 UTSW 3 99352511 missense probably damaging 0.99
R3118:Tbx15 UTSW 3 99352154 missense probably damaging 0.96
R4081:Tbx15 UTSW 3 99313054 missense possibly damaging 0.92
R4610:Tbx15 UTSW 3 99352367 missense probably damaging 1.00
R4898:Tbx15 UTSW 3 99352267 missense possibly damaging 0.95
R4950:Tbx15 UTSW 3 99326384 missense possibly damaging 0.82
R4982:Tbx15 UTSW 3 99254074 missense probably benign 0.06
R4999:Tbx15 UTSW 3 99316333 missense probably damaging 1.00
R5236:Tbx15 UTSW 3 99352046 missense possibly damaging 0.92
R5339:Tbx15 UTSW 3 99316284 missense possibly damaging 0.61
R5364:Tbx15 UTSW 3 99352192 missense possibly damaging 0.90
R5493:Tbx15 UTSW 3 99352564 missense probably benign
R5690:Tbx15 UTSW 3 99308850 missense probably damaging 0.99
R5756:Tbx15 UTSW 3 99313086 missense probably damaging 1.00
R6032:Tbx15 UTSW 3 99352517 missense probably benign 0.28
R6032:Tbx15 UTSW 3 99352517 missense probably benign 0.28
R6156:Tbx15 UTSW 3 99313115 critical splice donor site probably null
R6173:Tbx15 UTSW 3 99253887 nonsense probably null
R6596:Tbx15 UTSW 3 99352192 missense probably benign
R6680:Tbx15 UTSW 3 99313073 nonsense probably null
R6931:Tbx15 UTSW 3 99352151 missense probably damaging 1.00
R8129:Tbx15 UTSW 3 99253938 missense probably damaging 1.00
R8155:Tbx15 UTSW 3 99352570 missense possibly damaging 0.69
R8230:Tbx15 UTSW 3 99351989 missense probably damaging 1.00
R8729:Tbx15 UTSW 3 99313060 missense possibly damaging 0.90
R8929:Tbx15 UTSW 3 99314903 missense probably damaging 1.00
R9038:Tbx15 UTSW 3 99314769 missense probably benign 0.14
R9688:Tbx15 UTSW 3 99326392 missense possibly damaging 0.89
R9746:Tbx15 UTSW 3 99352331 missense probably damaging 1.00
X0023:Tbx15 UTSW 3 99314835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCAGAGTTTGTGAGCGC -3'
(R):5'- AGGCTCAAGGTATTTATGCCAAG -3'

Sequencing Primer
(F):5'- AGCTGGACTCAGTGCTCCATG -3'
(R):5'- GTATTTATGCCAAGAAAAAGGAACCC -3'
Posted On 2015-01-11