Incidental Mutation 'R3010:Armc8'
ID 257478
Institutional Source Beutler Lab
Gene Symbol Armc8
Ensembl Gene ENSMUSG00000032468
Gene Name armadillo repeat containing 8
Synonyms 1200015K23Rik, HSPC056, Gid5
Accession Numbers

Genbank: NM_028768; MGI: 1921375
Essential gene? Possibly essential (E-score: 0.685) question?
Stock # R3010 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 99478372-99568899 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99487913 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 591 (E591G)
Ref Sequence ENSEMBL: ENSMUSP00000035043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035043]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000035043
AA Change: E591G

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000035043
Gene: ENSMUSG00000032468
AA Change: E591G

DomainStartEndE-ValueType
ARM 50 92 1.75e0 SMART
ARM 94 134 5.34e0 SMART
ARM 177 217 2.04e1 SMART
ARM 372 413 3.58e1 SMART
Blast:ARM 414 455 7e-17 BLAST
ARM 457 497 3.81e-1 SMART
ARM 500 540 5.43e1 SMART
Blast:ARM 542 585 1e-20 BLAST
Blast:ARM 633 673 1e-16 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cers5 A G 15: 99,772,717 probably benign Het
Cgrrf1 T C 14: 46,853,766 V249A probably benign Het
Kctd1 T C 18: 14,974,086 E178G probably damaging Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Mx2 T C 16: 97,546,799 V208A possibly damaging Het
Pacs2 T C 12: 113,061,080 S427P probably benign Het
Pdzrn4 A G 15: 92,769,811 I615V probably benign Het
Ptpn1 C A 2: 167,974,822 Q266K probably damaging Het
Snx18 G A 13: 113,616,886 Q504* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
Tbx15 A G 3: 99,253,893 probably benign Het
Tdrd6 G A 17: 43,628,042 T705I probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Vmn2r113 T C 17: 22,958,131 S630P probably damaging Het
Zdbf2 T A 1: 63,303,065 V201D possibly damaging Het
Zer1 A G 2: 30,113,285 I40T probably benign Het
Other mutations in Armc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Armc8 APN 9 99505734 critical splice acceptor site probably null
IGL00951:Armc8 APN 9 99505704 missense probably benign 0.00
IGL01776:Armc8 APN 9 99526883 splice site probably benign
IGL02215:Armc8 APN 9 99483978 missense possibly damaging 0.92
IGL02244:Armc8 APN 9 99483174 missense probably benign 0.10
IGL02610:Armc8 APN 9 99527069 splice site probably benign
IGL02612:Armc8 APN 9 99527069 splice site probably benign
IGL02615:Armc8 APN 9 99527069 splice site probably benign
IGL02619:Armc8 APN 9 99527069 splice site probably benign
IGL02621:Armc8 APN 9 99527069 splice site probably benign
IGL02622:Armc8 APN 9 99527069 splice site probably benign
IGL02623:Armc8 APN 9 99527069 splice site probably benign
IGL02624:Armc8 APN 9 99527069 splice site probably benign
Scrambler UTSW 9 99496149 critical splice donor site probably null
warthog UTSW 9 99520485 missense probably benign 0.02
D4043:Armc8 UTSW 9 99483976 missense probably benign 0.13
R0321:Armc8 UTSW 9 99533177 missense probably damaging 0.99
R0498:Armc8 UTSW 9 99497292 missense probably damaging 1.00
R0646:Armc8 UTSW 9 99505688 missense probably damaging 1.00
R0658:Armc8 UTSW 9 99536158 splice site probably benign
R1061:Armc8 UTSW 9 99537731 missense probably damaging 1.00
R1406:Armc8 UTSW 9 99523248 missense probably benign 0.37
R1406:Armc8 UTSW 9 99523248 missense probably benign 0.37
R1429:Armc8 UTSW 9 99536207 missense possibly damaging 0.67
R1432:Armc8 UTSW 9 99523132 splice site probably benign
R1538:Armc8 UTSW 9 99505290 missense probably damaging 0.96
R1606:Armc8 UTSW 9 99537729 missense probably damaging 0.98
R1817:Armc8 UTSW 9 99536259 missense possibly damaging 0.67
R1866:Armc8 UTSW 9 99536280 missense probably benign
R2015:Armc8 UTSW 9 99483105 nonsense probably null
R2143:Armc8 UTSW 9 99505308 missense probably damaging 0.99
R2251:Armc8 UTSW 9 99502600 critical splice acceptor site probably null
R2842:Armc8 UTSW 9 99505681 missense probably benign
R3709:Armc8 UTSW 9 99520497 missense probably damaging 1.00
R4440:Armc8 UTSW 9 99484034 missense probably benign 0.37
R4865:Armc8 UTSW 9 99526889 critical splice donor site probably null
R5492:Armc8 UTSW 9 99527131 nonsense probably null
R5606:Armc8 UTSW 9 99536262 missense probably benign 0.23
R5639:Armc8 UTSW 9 99496149 critical splice donor site probably null
R5693:Armc8 UTSW 9 99496149 critical splice donor site probably null
R5694:Armc8 UTSW 9 99496149 critical splice donor site probably null
R5698:Armc8 UTSW 9 99535820 missense probably benign 0.12
R5700:Armc8 UTSW 9 99496149 critical splice donor site probably null
R5701:Armc8 UTSW 9 99496149 critical splice donor site probably null
R5735:Armc8 UTSW 9 99497394 critical splice acceptor site probably null
R6314:Armc8 UTSW 9 99535884 missense probably benign 0.28
R7034:Armc8 UTSW 9 99483965 critical splice donor site probably null
R7036:Armc8 UTSW 9 99483965 critical splice donor site probably null
R7393:Armc8 UTSW 9 99483999 missense possibly damaging 0.47
R7395:Armc8 UTSW 9 99533132 missense probably damaging 0.99
R7937:Armc8 UTSW 9 99536219 missense probably damaging 0.98
R8130:Armc8 UTSW 9 99551547 missense probably benign 0.02
R8373:Armc8 UTSW 9 99527099 missense probably benign 0.02
R8734:Armc8 UTSW 9 99520485 missense probably benign 0.02
R9098:Armc8 UTSW 9 99505309 nonsense probably null
R9255:Armc8 UTSW 9 99497388 missense possibly damaging 0.95
R9358:Armc8 UTSW 9 99568600 critical splice donor site probably null
R9463:Armc8 UTSW 9 99496150 critical splice donor site probably null
Z1177:Armc8 UTSW 9 99497386 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTGGGCTTGCTTTCTAC -3'
(R):5'- TCCGGTTTCCATCATCTGGG -3'

Sequencing Primer
(F):5'- GGGCTTGCTTTCTACTTTAGTATAC -3'
(R):5'- GGGTATCATATCCCCTGGAACTG -3'
Posted On 2015-01-11