Incidental Mutation 'R3010:Sppl2c'
ID257479
Institutional Source Beutler Lab
Gene Symbol Sppl2c
Ensembl Gene ENSMUSG00000049506
Gene Namesignal peptide peptidase 2C
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R3010 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location104186327-104191163 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104187315 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 314 (P314S)
Ref Sequence ENSEMBL: ENSMUSP00000102613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059448] [ENSMUST00000107000]
Predicted Effect probably benign
Transcript: ENSMUST00000059448
AA Change: P314S

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000091453
Gene: ENSMUSG00000049506
AA Change: P314S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:PA 62 169 1.8e-8 PFAM
transmembrane domain 191 213 N/A INTRINSIC
low complexity region 220 237 N/A INTRINSIC
PSN 256 528 1.08e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107000
AA Change: P314S

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102613
Gene: ENSMUSG00000049506
AA Change: P314S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:PA 62 169 2.3e-8 PFAM
transmembrane domain 191 213 N/A INTRINSIC
low complexity region 220 237 N/A INTRINSIC
PSN 256 528 1.08e-95 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Armc8 T C 9: 99,487,913 E591G probably benign Het
Cers5 A G 15: 99,772,717 probably benign Het
Cgrrf1 T C 14: 46,853,766 V249A probably benign Het
Kctd1 T C 18: 14,974,086 E178G probably damaging Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Mx2 T C 16: 97,546,799 V208A possibly damaging Het
Pacs2 T C 12: 113,061,080 S427P probably benign Het
Pdzrn4 A G 15: 92,769,811 I615V probably benign Het
Ptpn1 C A 2: 167,974,822 Q266K probably damaging Het
Snx18 G A 13: 113,616,886 Q504* probably null Het
Tbx15 A G 3: 99,253,893 probably benign Het
Tdrd6 G A 17: 43,628,042 T705I probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Vmn2r113 T C 17: 22,958,131 S630P probably damaging Het
Zdbf2 T A 1: 63,303,065 V201D possibly damaging Het
Zer1 A G 2: 30,113,285 I40T probably benign Het
Other mutations in Sppl2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Sppl2c APN 11 104186979 missense possibly damaging 0.83
IGL02326:Sppl2c APN 11 104187273 missense probably benign 0.27
IGL02479:Sppl2c APN 11 104186937 missense probably benign
H8786:Sppl2c UTSW 11 104186865 missense probably benign 0.04
R0083:Sppl2c UTSW 11 104186532 missense probably benign 0.00
R1625:Sppl2c UTSW 11 104187169 missense probably damaging 0.98
R1913:Sppl2c UTSW 11 104187889 missense probably benign 0.15
R2037:Sppl2c UTSW 11 104186481 missense probably benign 0.23
R2869:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R2869:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R2871:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R2871:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R2873:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R3009:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R3011:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R4698:Sppl2c UTSW 11 104188315 missense probably benign 0.21
R4718:Sppl2c UTSW 11 104188315 missense probably benign 0.21
R4841:Sppl2c UTSW 11 104187652 missense probably benign 0.06
R4842:Sppl2c UTSW 11 104187652 missense probably benign 0.06
R5248:Sppl2c UTSW 11 104186581 missense possibly damaging 0.88
R5288:Sppl2c UTSW 11 104187301 missense possibly damaging 0.68
R5300:Sppl2c UTSW 11 104187075 missense possibly damaging 0.52
R5384:Sppl2c UTSW 11 104187301 missense possibly damaging 0.68
R5386:Sppl2c UTSW 11 104187301 missense possibly damaging 0.68
R5427:Sppl2c UTSW 11 104187867 missense probably benign 0.01
R5452:Sppl2c UTSW 11 104187300 missense probably benign
R5796:Sppl2c UTSW 11 104187793 missense probably benign 0.00
R6112:Sppl2c UTSW 11 104187137 missense probably benign 0.00
R6452:Sppl2c UTSW 11 104188191 missense probably benign 0.01
R6476:Sppl2c UTSW 11 104186769 missense probably benign
R7368:Sppl2c UTSW 11 104187604 missense probably damaging 0.99
R7896:Sppl2c UTSW 11 104187130 missense possibly damaging 0.94
R7954:Sppl2c UTSW 11 104188516 utr 3 prime probably null
R7979:Sppl2c UTSW 11 104187130 missense possibly damaging 0.94
R8035:Sppl2c UTSW 11 104187366 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACGACTTTGAAGATGCACC -3'
(R):5'- AGTTCTTGAACGTGGGCAGC -3'

Sequencing Primer
(F):5'- CGACTTTGAAGATGCACCTATGG -3'
(R):5'- TGAACGTGGGCAGCCGTAC -3'
Posted On2015-01-11