Incidental Mutation 'R3010:Pdzrn4'
ID 257483
Institutional Source Beutler Lab
Gene Symbol Pdzrn4
Ensembl Gene ENSMUSG00000036218
Gene Name PDZ domain containing RING finger 4
Synonyms 1110017D07Rik, SAMCAP3L, LNX4
Accession Numbers
Essential gene? Probably non essential (E-score: 0.207) question?
Stock # R3010 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 92294762-92669700 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 92667692 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 615 (I615V)
Ref Sequence ENSEMBL: ENSMUSP00000133159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035399] [ENSMUST00000169942]
AlphaFold E9PUZ9
Predicted Effect probably benign
Transcript: ENSMUST00000035399
AA Change: I376V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000040456
Gene: ENSMUSG00000036218
AA Change: I376V

DomainStartEndE-ValueType
Blast:PDZ 1 56 4e-24 BLAST
SCOP:d1qaua_ 20 61 1e-3 SMART
PDB:1UHP|A 21 64 9e-12 PDB
PDZ 154 229 3.01e-18 SMART
low complexity region 240 259 N/A INTRINSIC
low complexity region 267 278 N/A INTRINSIC
coiled coil region 394 430 N/A INTRINSIC
low complexity region 563 577 N/A INTRINSIC
low complexity region 696 709 N/A INTRINSIC
low complexity region 732 741 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169942
AA Change: I615V

PolyPhen 2 Score 0.324 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: I615V

DomainStartEndE-ValueType
RING 22 56 1.38e-1 SMART
low complexity region 101 124 N/A INTRINSIC
PDZ 213 295 3.82e-20 SMART
PDZ 393 468 3.01e-18 SMART
low complexity region 479 498 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
coiled coil region 633 669 N/A INTRINSIC
low complexity region 802 816 N/A INTRINSIC
low complexity region 935 948 N/A INTRINSIC
low complexity region 971 980 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Armc8 T C 9: 99,369,966 (GRCm39) E591G probably benign Het
Cers5 A G 15: 99,670,598 (GRCm39) probably benign Het
Cgrrf1 T C 14: 47,091,223 (GRCm39) V249A probably benign Het
Kctd1 T C 18: 15,107,143 (GRCm39) E178G probably damaging Het
Mpp7 G A 18: 7,461,678 (GRCm39) P65L possibly damaging Het
Mx2 T C 16: 97,347,999 (GRCm39) V208A possibly damaging Het
Pacs2 T C 12: 113,024,700 (GRCm39) S427P probably benign Het
Ptpn1 C A 2: 167,816,742 (GRCm39) Q266K probably damaging Het
Snx18 G A 13: 113,753,422 (GRCm39) Q504* probably null Het
Sppl2c C T 11: 104,078,141 (GRCm39) P314S probably benign Het
Tbx15 A G 3: 99,161,209 (GRCm39) probably benign Het
Tdrd6 G A 17: 43,938,933 (GRCm39) T705I probably benign Het
Tex11 C A X: 99,977,021 (GRCm39) A487S possibly damaging Het
Vmn2r113 T C 17: 23,177,105 (GRCm39) S630P probably damaging Het
Zdbf2 T A 1: 63,342,224 (GRCm39) V201D possibly damaging Het
Zer1 A G 2: 30,003,297 (GRCm39) I40T probably benign Het
Other mutations in Pdzrn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01932:Pdzrn4 APN 15 92,644,159 (GRCm39) missense probably damaging 1.00
IGL01991:Pdzrn4 APN 15 92,299,807 (GRCm39) splice site probably null
IGL02103:Pdzrn4 APN 15 92,667,768 (GRCm39) missense probably damaging 1.00
IGL02243:Pdzrn4 APN 15 92,668,577 (GRCm39) missense probably benign 0.30
IGL02269:Pdzrn4 APN 15 92,667,731 (GRCm39) missense probably damaging 1.00
IGL03005:Pdzrn4 APN 15 92,668,272 (GRCm39) missense probably damaging 1.00
PIT4362001:Pdzrn4 UTSW 15 92,667,762 (GRCm39) missense possibly damaging 0.46
R0243:Pdzrn4 UTSW 15 92,668,200 (GRCm39) missense possibly damaging 0.46
R0367:Pdzrn4 UTSW 15 92,655,538 (GRCm39) missense possibly damaging 0.53
R0972:Pdzrn4 UTSW 15 92,655,592 (GRCm39) missense probably benign 0.00
R1168:Pdzrn4 UTSW 15 92,668,152 (GRCm39) missense probably benign 0.16
R1411:Pdzrn4 UTSW 15 92,668,894 (GRCm39) makesense probably null
R1466:Pdzrn4 UTSW 15 92,668,418 (GRCm39) missense probably benign 0.00
R1466:Pdzrn4 UTSW 15 92,668,418 (GRCm39) missense probably benign 0.00
R1489:Pdzrn4 UTSW 15 92,575,593 (GRCm39) missense probably benign
R1503:Pdzrn4 UTSW 15 92,297,685 (GRCm39) missense probably damaging 0.99
R1561:Pdzrn4 UTSW 15 92,575,518 (GRCm39) missense possibly damaging 0.84
R1584:Pdzrn4 UTSW 15 92,668,418 (GRCm39) missense probably benign 0.00
R1733:Pdzrn4 UTSW 15 92,299,855 (GRCm39) missense probably benign 0.06
R1965:Pdzrn4 UTSW 15 92,644,190 (GRCm39) splice site probably null
R2061:Pdzrn4 UTSW 15 92,668,041 (GRCm39) missense probably damaging 0.99
R4016:Pdzrn4 UTSW 15 92,297,630 (GRCm39) missense probably benign
R4032:Pdzrn4 UTSW 15 92,667,414 (GRCm39) missense probably damaging 1.00
R4110:Pdzrn4 UTSW 15 92,668,745 (GRCm39) missense probably benign 0.26
R4180:Pdzrn4 UTSW 15 92,299,898 (GRCm39) missense possibly damaging 0.93
R4539:Pdzrn4 UTSW 15 92,668,470 (GRCm39) missense probably damaging 1.00
R4617:Pdzrn4 UTSW 15 92,667,723 (GRCm39) missense probably damaging 1.00
R4734:Pdzrn4 UTSW 15 92,668,133 (GRCm39) nonsense probably null
R4900:Pdzrn4 UTSW 15 92,668,638 (GRCm39) missense probably damaging 1.00
R5422:Pdzrn4 UTSW 15 92,575,502 (GRCm39) missense probably benign 0.01
R5444:Pdzrn4 UTSW 15 92,668,806 (GRCm39) missense probably damaging 1.00
R5772:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R5775:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R5935:Pdzrn4 UTSW 15 92,295,255 (GRCm39) missense probably benign 0.01
R6192:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6210:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6258:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6259:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6391:Pdzrn4 UTSW 15 92,578,418 (GRCm39) missense probably damaging 0.99
R6613:Pdzrn4 UTSW 15 92,575,455 (GRCm39) missense probably damaging 0.99
R7046:Pdzrn4 UTSW 15 92,668,303 (GRCm39) nonsense probably null
R7096:Pdzrn4 UTSW 15 92,295,384 (GRCm39) missense probably benign 0.00
R7451:Pdzrn4 UTSW 15 92,667,948 (GRCm39) missense possibly damaging 0.68
R8075:Pdzrn4 UTSW 15 92,575,605 (GRCm39) missense probably damaging 0.99
R8125:Pdzrn4 UTSW 15 92,641,476 (GRCm39) missense probably damaging 1.00
R8324:Pdzrn4 UTSW 15 92,668,818 (GRCm39) missense probably damaging 1.00
R9332:Pdzrn4 UTSW 15 92,295,216 (GRCm39) missense probably benign
R9555:Pdzrn4 UTSW 15 92,297,703 (GRCm39) missense probably damaging 1.00
R9558:Pdzrn4 UTSW 15 92,299,877 (GRCm39) missense possibly damaging 0.46
R9622:Pdzrn4 UTSW 15 92,294,949 (GRCm39) missense probably benign
R9763:Pdzrn4 UTSW 15 92,668,376 (GRCm39) missense probably damaging 1.00
R9796:Pdzrn4 UTSW 15 92,578,353 (GRCm39) missense possibly damaging 0.93
X0018:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0020:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0021:Pdzrn4 UTSW 15 92,575,590 (GRCm39) missense probably damaging 1.00
X0026:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0027:Pdzrn4 UTSW 15 92,578,393 (GRCm39) missense possibly damaging 0.92
X0027:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0065:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
Z1176:Pdzrn4 UTSW 15 92,294,838 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTGCGGAATGATGAGAGCTC -3'
(R):5'- GATGTCTCCGTATTGGTCCG -3'

Sequencing Primer
(F):5'- CTCAGAGCAGGAGAACGC -3'
(R):5'- GGTCCGTCACTTTCTGGAGC -3'
Posted On 2015-01-11