Incidental Mutation 'R3010:Mx2'
ID257484
Institutional Source Beutler Lab
Gene Symbol Mx2
Ensembl Gene ENSMUSG00000023341
Gene NameMX dynamin-like GTPase 2
SynonymsMx-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R3010 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location97535308-97560900 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97546799 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 208 (V208A)
Ref Sequence ENSEMBL: ENSMUSP00000141038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024112] [ENSMUST00000188251] [ENSMUST00000190447]
Predicted Effect probably benign
Transcript: ENSMUST00000024112
AA Change: V208A

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000024112
Gene: ENSMUSG00000023341
AA Change: V208A

DomainStartEndE-ValueType
DYNc 39 282 2.71e-135 SMART
Blast:DYNc 426 539 4e-17 BLAST
GED 562 653 9.88e-30 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000188251
AA Change: V208A

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141038
Gene: ENSMUSG00000023341
AA Change: V208A

DomainStartEndE-ValueType
DYNc 39 282 1.3e-137 SMART
low complexity region 592 603 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190097
Predicted Effect probably benign
Transcript: ENSMUST00000190447
AA Change: V208A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000140229
Gene: ENSMUSG00000023341
AA Change: V208A

DomainStartEndE-ValueType
DYNc 39 282 1.3e-137 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype Mx1+ strains do not express MX2 protein. The Mx2 gene in BALB/cJ and CBA/J is interrupted by an open reading frame mutation. Mutagenesis correcting the frameshift permits Mx2 expression in 3T3 cells. This protein did not inhibit influenza virus but conferred resistance to vesicular stomatitis virus.
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Armc8 T C 9: 99,487,913 E591G probably benign Het
Cers5 A G 15: 99,772,717 probably benign Het
Cgrrf1 T C 14: 46,853,766 V249A probably benign Het
Kctd1 T C 18: 14,974,086 E178G probably damaging Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Pacs2 T C 12: 113,061,080 S427P probably benign Het
Pdzrn4 A G 15: 92,769,811 I615V probably benign Het
Ptpn1 C A 2: 167,974,822 Q266K probably damaging Het
Snx18 G A 13: 113,616,886 Q504* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
Tbx15 A G 3: 99,253,893 probably benign Het
Tdrd6 G A 17: 43,628,042 T705I probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Vmn2r113 T C 17: 22,958,131 S630P probably damaging Het
Zdbf2 T A 1: 63,303,065 V201D possibly damaging Het
Zer1 A G 2: 30,113,285 I40T probably benign Het
Other mutations in Mx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Mx2 APN 16 97544478 missense probably damaging 0.99
IGL01111:Mx2 APN 16 97558719 missense probably benign
IGL02103:Mx2 APN 16 97544595 missense probably damaging 1.00
IGL02678:Mx2 APN 16 97556120 critical splice donor site probably null
IGL03166:Mx2 APN 16 97546790 missense probably damaging 1.00
IGL03323:Mx2 APN 16 97546375 missense probably damaging 0.99
R0254:Mx2 UTSW 16 97556095 missense probably benign
R0699:Mx2 UTSW 16 97544553 missense probably damaging 1.00
R1180:Mx2 UTSW 16 97556009 missense probably damaging 1.00
R1702:Mx2 UTSW 16 97558683 missense probably benign
R1762:Mx2 UTSW 16 97538703 missense probably benign 0.09
R1922:Mx2 UTSW 16 97560351 missense probably benign 0.05
R2049:Mx2 UTSW 16 97538703 missense probably benign 0.09
R2141:Mx2 UTSW 16 97538703 missense probably benign 0.09
R2142:Mx2 UTSW 16 97538703 missense probably benign 0.09
R4079:Mx2 UTSW 16 97556036 missense probably damaging 0.98
R4553:Mx2 UTSW 16 97552005 missense possibly damaging 0.52
R4594:Mx2 UTSW 16 97547432 nonsense probably null
R5211:Mx2 UTSW 16 97547433 missense probably damaging 1.00
R5785:Mx2 UTSW 16 97538704 missense possibly damaging 0.90
R6091:Mx2 UTSW 16 97546435 missense probably damaging 1.00
R7250:Mx2 UTSW 16 97547464 missense probably damaging 0.99
R7485:Mx2 UTSW 16 97545718 missense probably benign 0.11
R7793:Mx2 UTSW 16 97546883 missense probably damaging 1.00
R7816:Mx2 UTSW 16 97545612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTGGATAGCTAGGCTTTACC -3'
(R):5'- TGGCCTCATTTAGACCCTGAG -3'

Sequencing Primer
(F):5'- ACCTCAACGTTTGATGGAGAC -3'
(R):5'- TCATTTAGACCCTGAGCATGG -3'
Posted On2015-01-11