Incidental Mutation 'R3011:Mgat4e'
ID257494
Institutional Source Beutler Lab
Gene Symbol Mgat4e
Ensembl Gene ENSMUSG00000046367
Gene NameMGAT4 family, member E
Synonyms4931440L10Rik
MMRRC Submission 040533-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R3011 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location134540941-134549682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 134542108 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 66 (D66V)
Ref Sequence ENSEMBL: ENSMUSP00000133717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052911] [ENSMUST00000172898] [ENSMUST00000185836]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052911
AA Change: D66V

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125929
Gene: ENSMUSG00000046367
AA Change: D66V

DomainStartEndE-ValueType
Pfam:Glyco_transf_54 35 266 5e-61 PFAM
low complexity region 425 438 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172898
AA Change: D66V

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133717
Gene: ENSMUSG00000046367
AA Change: D66V

DomainStartEndE-ValueType
Pfam:Glyco_transf_54 33 268 5.9e-61 PFAM
low complexity region 425 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185836
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik C A 8: 84,166,910 Y235* probably null Het
Arhgap31 A C 16: 38,601,907 C1266G possibly damaging Het
Cers5 A G 15: 99,772,717 probably benign Het
Clasp2 C T 9: 113,901,513 T905M probably damaging Het
Clec16a A G 16: 10,611,111 N469S probably benign Het
Commd3 T A 2: 18,674,688 V128D probably damaging Het
Cped1 A G 6: 22,088,696 T253A probably damaging Het
Dnajc5b A T 3: 19,546,802 Y21F probably damaging Het
Fam160b1 T A 19: 57,385,288 L660Q probably damaging Het
Gm14403 A G 2: 177,508,993 D244G probably benign Het
Gm5414 T C 15: 101,625,612 D312G probably damaging Het
Gm884 T A 11: 103,613,103 T504S possibly damaging Het
Ifi204 T C 1: 173,751,651 S543G probably benign Het
Itga11 T A 9: 62,696,980 I50N probably damaging Het
Lct C T 1: 128,301,372 V795I possibly damaging Het
Map2 A G 1: 66,414,612 D887G probably damaging Het
Nqo1 C T 8: 107,389,111 R178H probably benign Het
Olfr190 A G 16: 59,074,987 V31A probably benign Het
Olfr70 G T 4: 43,696,624 A183E probably damaging Het
Otof G A 5: 30,382,840 A999V probably damaging Het
Phf20 A G 2: 156,288,026 D506G probably benign Het
Pth2r C T 1: 65,336,988 H97Y probably benign Het
Snx18 G A 13: 113,616,886 Q504* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
Srgap2 T A 1: 131,310,591 Q520L probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tlr4 A T 4: 66,839,254 K95* probably null Het
Tmem59l A T 8: 70,486,237 C96S probably damaging Het
Tmtc3 G T 10: 100,447,582 P704T possibly damaging Het
Upp2 T C 2: 58,790,095 V293A probably damaging Het
Vps72 A G 3: 95,119,274 K177E probably damaging Het
Other mutations in Mgat4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Mgat4e APN 1 134541449 missense probably damaging 1.00
IGL02863:Mgat4e APN 1 134541158 missense probably benign
IGL02999:Mgat4e APN 1 134541190 missense probably damaging 1.00
FR4449:Mgat4e UTSW 1 134540997 utr 3 prime probably benign
PIT4480001:Mgat4e UTSW 1 134541365 missense possibly damaging 0.57
R0226:Mgat4e UTSW 1 134541103 missense probably benign
R1396:Mgat4e UTSW 1 134541533 missense probably benign 0.18
R1626:Mgat4e UTSW 1 134541278 missense probably benign 0.08
R2020:Mgat4e UTSW 1 134541322 missense probably damaging 1.00
R4748:Mgat4e UTSW 1 134542028 missense probably damaging 1.00
R4784:Mgat4e UTSW 1 134541325 missense probably damaging 0.98
R4859:Mgat4e UTSW 1 134541740 missense possibly damaging 0.84
R4894:Mgat4e UTSW 1 134541118 missense probably benign 0.23
R4910:Mgat4e UTSW 1 134541864 missense probably damaging 1.00
R5007:Mgat4e UTSW 1 134541152 missense probably benign 0.39
R5108:Mgat4e UTSW 1 134541223 missense probably benign 0.03
R5691:Mgat4e UTSW 1 134540991 utr 3 prime probably benign
R5994:Mgat4e UTSW 1 134541496 missense probably benign 0.05
R6467:Mgat4e UTSW 1 134541206 missense probably benign 0.01
R7155:Mgat4e UTSW 1 134541959 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCGTGGATCAGTAACAATTGC -3'
(R):5'- CAAGTAGCATCCTCTGATCTTTAAG -3'

Sequencing Primer
(F):5'- AATTGCCCTGTCAAGATCTGGGAC -3'
(R):5'- ACAGGCAGTTGTAAGCTTCC -3'
Posted On2015-01-11