Incidental Mutation 'R3011:Ifi204'
ID257495
Institutional Source Beutler Lab
Gene Symbol Ifi204
Ensembl Gene ENSMUSG00000073489
Gene Nameinterferon activated gene 204
Synonymsp204
MMRRC Submission 040533-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R3011 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location173747293-173766943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 173751651 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 543 (S543G)
Ref Sequence ENSEMBL: ENSMUSP00000106845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111214]
Predicted Effect probably benign
Transcript: ENSMUST00000111214
AA Change: S543G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000106845
Gene: ENSMUSG00000073489
AA Change: S543G

DomainStartEndE-ValueType
PYRIN 6 84 8.33e-14 SMART
low complexity region 120 154 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
Pfam:HIN 225 393 6.2e-78 PFAM
Pfam:HIN 429 595 9.8e-78 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik C A 8: 84,166,910 Y235* probably null Het
Arhgap31 A C 16: 38,601,907 C1266G possibly damaging Het
Cers5 A G 15: 99,772,717 probably benign Het
Clasp2 C T 9: 113,901,513 T905M probably damaging Het
Clec16a A G 16: 10,611,111 N469S probably benign Het
Commd3 T A 2: 18,674,688 V128D probably damaging Het
Cped1 A G 6: 22,088,696 T253A probably damaging Het
Dnajc5b A T 3: 19,546,802 Y21F probably damaging Het
Fam160b1 T A 19: 57,385,288 L660Q probably damaging Het
Gm14403 A G 2: 177,508,993 D244G probably benign Het
Gm5414 T C 15: 101,625,612 D312G probably damaging Het
Gm884 T A 11: 103,613,103 T504S possibly damaging Het
Itga11 T A 9: 62,696,980 I50N probably damaging Het
Lct C T 1: 128,301,372 V795I possibly damaging Het
Map2 A G 1: 66,414,612 D887G probably damaging Het
Mgat4e T A 1: 134,542,108 D66V possibly damaging Het
Nqo1 C T 8: 107,389,111 R178H probably benign Het
Olfr190 A G 16: 59,074,987 V31A probably benign Het
Olfr70 G T 4: 43,696,624 A183E probably damaging Het
Otof G A 5: 30,382,840 A999V probably damaging Het
Phf20 A G 2: 156,288,026 D506G probably benign Het
Pth2r C T 1: 65,336,988 H97Y probably benign Het
Snx18 G A 13: 113,616,886 Q504* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
Srgap2 T A 1: 131,310,591 Q520L probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tlr4 A T 4: 66,839,254 K95* probably null Het
Tmem59l A T 8: 70,486,237 C96S probably damaging Het
Tmtc3 G T 10: 100,447,582 P704T possibly damaging Het
Upp2 T C 2: 58,790,095 V293A probably damaging Het
Vps72 A G 3: 95,119,274 K177E probably damaging Het
Other mutations in Ifi204
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Ifi204 APN 1 173759631 splice site probably benign
IGL01922:Ifi204 APN 1 173761722 missense possibly damaging 0.51
IGL02296:Ifi204 APN 1 173749314 missense possibly damaging 0.93
IGL02419:Ifi204 APN 1 173749380 missense possibly damaging 0.71
IGL02505:Ifi204 APN 1 173755654 missense probably benign 0.04
R0938:Ifi204 UTSW 1 173751745 missense possibly damaging 0.85
R1363:Ifi204 UTSW 1 173749296 missense probably benign 0.00
R1834:Ifi204 UTSW 1 173747606 missense unknown
R2031:Ifi204 UTSW 1 173752777 missense probably damaging 1.00
R2254:Ifi204 UTSW 1 173761730 missense possibly damaging 0.95
R2379:Ifi204 UTSW 1 173755993 nonsense probably null
R2408:Ifi204 UTSW 1 173755632 missense possibly damaging 0.80
R3617:Ifi204 UTSW 1 173755717 missense possibly damaging 0.51
R3894:Ifi204 UTSW 1 173749208 missense possibly damaging 0.86
R3916:Ifi204 UTSW 1 173755775 missense possibly damaging 0.95
R4656:Ifi204 UTSW 1 173760361 intron probably benign
R4657:Ifi204 UTSW 1 173760361 intron probably benign
R4694:Ifi204 UTSW 1 173749259 missense probably damaging 0.99
R4703:Ifi204 UTSW 1 173760361 intron probably benign
R4704:Ifi204 UTSW 1 173760361 intron probably benign
R4894:Ifi204 UTSW 1 173760242 missense probably damaging 0.98
R4947:Ifi204 UTSW 1 173755750 missense probably damaging 0.98
R5023:Ifi204 UTSW 1 173751740 missense possibly damaging 0.93
R5036:Ifi204 UTSW 1 173752745 missense possibly damaging 0.79
R5119:Ifi204 UTSW 1 173755668 missense probably damaging 1.00
R5194:Ifi204 UTSW 1 173749344 missense possibly damaging 0.86
R5762:Ifi204 UTSW 1 173752759 missense probably damaging 0.98
R6063:Ifi204 UTSW 1 173751657 missense probably benign 0.03
R6808:Ifi204 UTSW 1 173761703 missense probably benign 0.27
R7311:Ifi204 UTSW 1 173759568 missense probably benign 0.26
R7338:Ifi204 UTSW 1 173760137 missense possibly damaging 0.67
R7430:Ifi204 UTSW 1 173755681 missense probably benign 0.43
R7528:Ifi204 UTSW 1 173751840 missense probably benign 0.06
Z1176:Ifi204 UTSW 1 173751628 missense probably null 0.00
Predicted Primers PCR Primer
(F):5'- AGTGAGGAAGCCTGGTCTTG -3'
(R):5'- CTACCGTGGCTACTGAAACTG -3'

Sequencing Primer
(F):5'- GCCTGGTCTCTTTCTGCTATGG -3'
(R):5'- ACCGTGGCTACTGAAACTGAGTTC -3'
Posted On2015-01-11