Incidental Mutation 'R3011:Commd3'
ID257496
Institutional Source Beutler Lab
Gene Symbol Commd3
Ensembl Gene ENSMUSG00000051154
Gene NameCOMM domain containing 3
SynonymsBup, D2Ertd542e
MMRRC Submission 040533-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.656) question?
Stock #R3011 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location18672384-18676231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18674688 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 128 (V128D)
Ref Sequence ENSEMBL: ENSMUSP00000127385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028071] [ENSMUST00000061158] [ENSMUST00000150834] [ENSMUST00000171845]
Predicted Effect probably benign
Transcript: ENSMUST00000028071
SMART Domains Protein: ENSMUSP00000028071
Gene: ENSMUSG00000026739

DomainStartEndE-ValueType
RING 18 56 4.34e-5 SMART
low complexity region 146 159 N/A INTRINSIC
low complexity region 264 276 N/A INTRINSIC
low complexity region 313 323 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000061158
AA Change: V128D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049882
Gene: ENSMUSG00000051154
AA Change: V128D

DomainStartEndE-ValueType
Pfam:HCaRG 18 191 5.4e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150590
Predicted Effect probably benign
Transcript: ENSMUST00000150834
SMART Domains Protein: ENSMUSP00000119331
Gene: ENSMUSG00000026739

DomainStartEndE-ValueType
RING 18 56 4.34e-5 SMART
low complexity region 146 159 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151974
Predicted Effect probably damaging
Transcript: ENSMUST00000171845
AA Change: V128D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127385
Gene: ENSMUSG00000051154
AA Change: V128D

DomainStartEndE-ValueType
Pfam:HCaRG 14 192 1.2e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154519
Meta Mutation Damage Score 0.9077 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik C A 8: 84,166,910 Y235* probably null Het
Arhgap31 A C 16: 38,601,907 C1266G possibly damaging Het
Cers5 A G 15: 99,772,717 probably benign Het
Clasp2 C T 9: 113,901,513 T905M probably damaging Het
Clec16a A G 16: 10,611,111 N469S probably benign Het
Cped1 A G 6: 22,088,696 T253A probably damaging Het
Dnajc5b A T 3: 19,546,802 Y21F probably damaging Het
Fam160b1 T A 19: 57,385,288 L660Q probably damaging Het
Gm14403 A G 2: 177,508,993 D244G probably benign Het
Gm5414 T C 15: 101,625,612 D312G probably damaging Het
Gm884 T A 11: 103,613,103 T504S possibly damaging Het
Ifi204 T C 1: 173,751,651 S543G probably benign Het
Itga11 T A 9: 62,696,980 I50N probably damaging Het
Lct C T 1: 128,301,372 V795I possibly damaging Het
Map2 A G 1: 66,414,612 D887G probably damaging Het
Mgat4e T A 1: 134,542,108 D66V possibly damaging Het
Nqo1 C T 8: 107,389,111 R178H probably benign Het
Olfr190 A G 16: 59,074,987 V31A probably benign Het
Olfr70 G T 4: 43,696,624 A183E probably damaging Het
Otof G A 5: 30,382,840 A999V probably damaging Het
Phf20 A G 2: 156,288,026 D506G probably benign Het
Pth2r C T 1: 65,336,988 H97Y probably benign Het
Snx18 G A 13: 113,616,886 Q504* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
Srgap2 T A 1: 131,310,591 Q520L probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tlr4 A T 4: 66,839,254 K95* probably null Het
Tmem59l A T 8: 70,486,237 C96S probably damaging Het
Tmtc3 G T 10: 100,447,582 P704T possibly damaging Het
Upp2 T C 2: 58,790,095 V293A probably damaging Het
Vps72 A G 3: 95,119,274 K177E probably damaging Het
Other mutations in Commd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Commd3 APN 2 18673928 missense possibly damaging 0.68
IGL00972:Commd3 APN 2 18674665 missense probably benign 0.04
IGL01309:Commd3 APN 2 18672478 missense probably benign 0.26
IGL01575:Commd3 APN 2 18674717 critical splice donor site probably null
IGL02207:Commd3 APN 2 18674008 critical splice donor site probably null
R0062:Commd3 UTSW 2 18674703 splice site probably null
R0062:Commd3 UTSW 2 18674703 splice site probably null
R0699:Commd3 UTSW 2 18674975 missense possibly damaging 0.50
R1223:Commd3 UTSW 2 18674968 missense probably benign 0.00
R1959:Commd3 UTSW 2 18673963 missense probably benign 0.07
R4710:Commd3 UTSW 2 18674282 missense probably benign 0.02
R4821:Commd3 UTSW 2 18672528 missense probably benign
R5098:Commd3 UTSW 2 18674177 missense possibly damaging 0.85
R5456:Commd3 UTSW 2 18674157 missense probably damaging 0.96
R5891:Commd3 UTSW 2 18673815 intron probably benign
R6511:Commd3 UTSW 2 18674839 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGATCCTGACCCAAAATAAAG -3'
(R):5'- CATTTAAGGTCACCAAATATCCAGG -3'

Sequencing Primer
(F):5'- CCTGACATAATCTTAGTAGGTGTGC -3'
(R):5'- CCAGGTCGGTACATCTTATGAAG -3'
Posted On2015-01-11