Incidental Mutation 'R3011:Phf20'
ID257498
Institutional Source Beutler Lab
Gene Symbol Phf20
Ensembl Gene ENSMUSG00000038116
Gene NamePHD finger protein 20
Synonyms
MMRRC Submission 040533-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock #R3011 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location156196466-156309952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 156288026 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 506 (D506G)
Ref Sequence ENSEMBL: ENSMUSP00000043138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037401]
Predicted Effect probably benign
Transcript: ENSMUST00000037401
AA Change: D506G

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000043138
Gene: ENSMUSG00000038116
AA Change: D506G

DomainStartEndE-ValueType
TUDOR 11 71 5.27e0 SMART
TUDOR 85 141 7.13e-4 SMART
AT_hook 257 269 1.65e0 SMART
low complexity region 323 332 N/A INTRINSIC
ZnF_C2H2 455 480 1.86e0 SMART
low complexity region 486 493 N/A INTRINSIC
low complexity region 526 555 N/A INTRINSIC
low complexity region 612 630 N/A INTRINSIC
PHD 657 701 2.83e-4 SMART
coiled coil region 945 966 N/A INTRINSIC
low complexity region 974 987 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152617
Meta Mutation Damage Score 0.1007 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (29/29)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, decreased body size and total body fat amount, and abnormal skeletal and hematopoietic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik C A 8: 84,166,910 Y235* probably null Het
Arhgap31 A C 16: 38,601,907 C1266G possibly damaging Het
Cers5 A G 15: 99,772,717 probably benign Het
Clasp2 C T 9: 113,901,513 T905M probably damaging Het
Clec16a A G 16: 10,611,111 N469S probably benign Het
Commd3 T A 2: 18,674,688 V128D probably damaging Het
Cped1 A G 6: 22,088,696 T253A probably damaging Het
Dnajc5b A T 3: 19,546,802 Y21F probably damaging Het
Fam160b1 T A 19: 57,385,288 L660Q probably damaging Het
Gm14403 A G 2: 177,508,993 D244G probably benign Het
Gm5414 T C 15: 101,625,612 D312G probably damaging Het
Gm884 T A 11: 103,613,103 T504S possibly damaging Het
Ifi204 T C 1: 173,751,651 S543G probably benign Het
Itga11 T A 9: 62,696,980 I50N probably damaging Het
Lct C T 1: 128,301,372 V795I possibly damaging Het
Map2 A G 1: 66,414,612 D887G probably damaging Het
Mgat4e T A 1: 134,542,108 D66V possibly damaging Het
Nqo1 C T 8: 107,389,111 R178H probably benign Het
Olfr190 A G 16: 59,074,987 V31A probably benign Het
Olfr70 G T 4: 43,696,624 A183E probably damaging Het
Otof G A 5: 30,382,840 A999V probably damaging Het
Pth2r C T 1: 65,336,988 H97Y probably benign Het
Snx18 G A 13: 113,616,886 Q504* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
Srgap2 T A 1: 131,310,591 Q520L probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tlr4 A T 4: 66,839,254 K95* probably null Het
Tmem59l A T 8: 70,486,237 C96S probably damaging Het
Tmtc3 G T 10: 100,447,582 P704T possibly damaging Het
Upp2 T C 2: 58,790,095 V293A probably damaging Het
Vps72 A G 3: 95,119,274 K177E probably damaging Het
Other mutations in Phf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Phf20 APN 2 156304816 critical splice donor site probably null
IGL01071:Phf20 APN 2 156294088 splice site probably null
IGL01125:Phf20 APN 2 156303184 splice site probably null
IGL01608:Phf20 APN 2 156276596 missense probably benign
IGL01610:Phf20 APN 2 156302889 nonsense probably null
IGL01845:Phf20 APN 2 156276657 nonsense probably null
IGL02364:Phf20 APN 2 156294097 missense possibly damaging 0.80
IGL02692:Phf20 APN 2 156298578 missense probably damaging 1.00
IGL03039:Phf20 APN 2 156298541 missense probably damaging 1.00
R0016:Phf20 UTSW 2 156267194 nonsense probably null
R0189:Phf20 UTSW 2 156303141 missense probably benign 0.02
R1532:Phf20 UTSW 2 156303049 missense possibly damaging 0.89
R1572:Phf20 UTSW 2 156287834 missense probably benign 0.17
R2007:Phf20 UTSW 2 156287954 missense probably benign 0.00
R2191:Phf20 UTSW 2 156276654 missense probably benign
R3024:Phf20 UTSW 2 156287867 missense probably damaging 0.96
R4242:Phf20 UTSW 2 156307454 unclassified probably benign
R5053:Phf20 UTSW 2 156273862 missense probably benign 0.00
R5089:Phf20 UTSW 2 156302862 missense probably benign
R5382:Phf20 UTSW 2 156267497 missense probably damaging 1.00
R5649:Phf20 UTSW 2 156251768 splice site probably null
R5707:Phf20 UTSW 2 156296771 intron probably null
R5751:Phf20 UTSW 2 156267341 missense probably benign 0.01
R5805:Phf20 UTSW 2 156307294 missense probably damaging 0.99
R5988:Phf20 UTSW 2 156307330 missense probably damaging 1.00
R6179:Phf20 UTSW 2 156298653 missense probably damaging 1.00
R6243:Phf20 UTSW 2 156223400 missense probably benign 0.16
R6338:Phf20 UTSW 2 156273686 missense possibly damaging 0.93
R6351:Phf20 UTSW 2 156294210 missense possibly damaging 0.91
R6584:Phf20 UTSW 2 156294123 missense probably damaging 0.99
R7248:Phf20 UTSW 2 156293411 splice site probably null
R7329:Phf20 UTSW 2 156304632 missense probably damaging 0.96
R7387:Phf20 UTSW 2 156294240 missense probably damaging 1.00
R7528:Phf20 UTSW 2 156303008 nonsense probably null
R7603:Phf20 UTSW 2 156302851 missense probably benign
R7698:Phf20 UTSW 2 156294138 missense probably damaging 1.00
RF011:Phf20 UTSW 2 156304620 critical splice acceptor site probably benign
RF011:Phf20 UTSW 2 156304621 critical splice acceptor site probably benign
RF028:Phf20 UTSW 2 156304623 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- ACCTAGACCACAAGTTTCGATG -3'
(R):5'- AGGAATGCCACAGCCTTCAG -3'

Sequencing Primer
(F):5'- GACCACAAGTTTCGATGCAAGGTTC -3'
(R):5'- TCAGCAGTAACTCCCTCACTG -3'
Posted On2015-01-11