Incidental Mutation 'R3011:Vps72'
ID257501
Institutional Source Beutler Lab
Gene Symbol Vps72
Ensembl Gene ENSMUSG00000008958
Gene Namevacuolar protein sorting 72
SynonymsYL-1, Tcfl1
MMRRC Submission 040533-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3011 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95111022-95123051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95119274 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 177 (K177E)
Ref Sequence ENSEMBL: ENSMUSP00000009102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009102]
Predicted Effect probably damaging
Transcript: ENSMUST00000009102
AA Change: K177E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000009102
Gene: ENSMUSG00000008958
AA Change: K177E

DomainStartEndE-ValueType
Pfam:YL1 5 216 5.1e-58 PFAM
low complexity region 247 264 N/A INTRINSIC
YL1_C 294 323 5.99e-9 SMART
low complexity region 335 358 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152333
Meta Mutation Damage Score 0.1032 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a shared subunit of two multi-component complexes, the histone acetyltransferase complex TRRAP/TIP60 as well as the chromatin remodeling SRCAP-containing complex. The TRRAP/TIP60 complex acetylates nucleosomal histones important for transcriptional regulation, double strand DNA break repair and apoptosis. The SRCAP-containing complex catalyzes the exchange of histone H2A with the histone variant Htz1 (H2AFZ) into nucleosomes. This protein may be responsible for binding H2AFZ, which has a role in chromosome segregation. This protein may also have a role in regulating long-term hematopoietic stem cell activity. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik C A 8: 84,166,910 Y235* probably null Het
Arhgap31 A C 16: 38,601,907 C1266G possibly damaging Het
Cers5 A G 15: 99,772,717 probably benign Het
Clasp2 C T 9: 113,901,513 T905M probably damaging Het
Clec16a A G 16: 10,611,111 N469S probably benign Het
Commd3 T A 2: 18,674,688 V128D probably damaging Het
Cped1 A G 6: 22,088,696 T253A probably damaging Het
Dnajc5b A T 3: 19,546,802 Y21F probably damaging Het
Fam160b1 T A 19: 57,385,288 L660Q probably damaging Het
Gm14403 A G 2: 177,508,993 D244G probably benign Het
Gm5414 T C 15: 101,625,612 D312G probably damaging Het
Gm884 T A 11: 103,613,103 T504S possibly damaging Het
Ifi204 T C 1: 173,751,651 S543G probably benign Het
Itga11 T A 9: 62,696,980 I50N probably damaging Het
Lct C T 1: 128,301,372 V795I possibly damaging Het
Map2 A G 1: 66,414,612 D887G probably damaging Het
Mgat4e T A 1: 134,542,108 D66V possibly damaging Het
Nqo1 C T 8: 107,389,111 R178H probably benign Het
Olfr190 A G 16: 59,074,987 V31A probably benign Het
Olfr70 G T 4: 43,696,624 A183E probably damaging Het
Otof G A 5: 30,382,840 A999V probably damaging Het
Phf20 A G 2: 156,288,026 D506G probably benign Het
Pth2r C T 1: 65,336,988 H97Y probably benign Het
Snx18 G A 13: 113,616,886 Q504* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
Srgap2 T A 1: 131,310,591 Q520L probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tlr4 A T 4: 66,839,254 K95* probably null Het
Tmem59l A T 8: 70,486,237 C96S probably damaging Het
Tmtc3 G T 10: 100,447,582 P704T possibly damaging Het
Upp2 T C 2: 58,790,095 V293A probably damaging Het
Other mutations in Vps72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02051:Vps72 APN 3 95122729 missense possibly damaging 0.96
IGL02802:Vps72 UTSW 3 95119234 nonsense probably null
R0135:Vps72 UTSW 3 95119197 missense probably damaging 0.99
R0197:Vps72 UTSW 3 95122583 missense probably damaging 0.97
R0463:Vps72 UTSW 3 95121304 missense probably benign 0.41
R0883:Vps72 UTSW 3 95122583 missense probably damaging 0.97
R1101:Vps72 UTSW 3 95119176 missense probably damaging 1.00
R1484:Vps72 UTSW 3 95119151 missense probably damaging 1.00
R1698:Vps72 UTSW 3 95118695 missense probably benign 0.00
R1839:Vps72 UTSW 3 95119218 missense possibly damaging 0.70
R1935:Vps72 UTSW 3 95122540 missense probably benign 0.01
R1936:Vps72 UTSW 3 95122540 missense probably benign 0.01
R4877:Vps72 UTSW 3 95118187 intron probably benign
RF018:Vps72 UTSW 3 95121408 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGAATTCAGAGCTTTCTTCCCATC -3'
(R):5'- GTGTTTCAAGACAAAGCCCC -3'

Sequencing Primer
(F):5'- ATCTCACTATCTGCAGGCCG -3'
(R):5'- AAAGCCCCTTCTACAGAGTCTTGG -3'
Posted On2015-01-11