Incidental Mutation 'R3012:Ifi208'
ID257525
Institutional Source Beutler Lab
Gene Symbol Ifi208
Ensembl Gene ENSMUSG00000066677
Gene Nameinterferon activated gene 208
SynonymsPydc3, E430029J22Rik, Pyr-rv1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3012 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location173673675-173698395 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 173695570 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085876] [ENSMUST00000169857]
Predicted Effect probably null
Transcript: ENSMUST00000085876
SMART Domains Protein: ENSMUSP00000083039
Gene: ENSMUSG00000066677

DomainStartEndE-ValueType
PYRIN 10 88 3.23e-20 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
low complexity region 488 504 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169857
SMART Domains Protein: ENSMUSP00000128958
Gene: ENSMUSG00000066677

DomainStartEndE-ValueType
PYRIN 10 88 3.23e-20 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
Pfam:HERV-K_REC 502 580 3.5e-9 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh18a1 G T 19: 40,557,691 Y585* probably null Het
Ankrd17 G A 5: 90,230,868 P2563S probably damaging Het
Atg10 A T 13: 91,154,278 F47Y probably damaging Het
Ccdc39 C T 3: 33,814,668 R798Q probably damaging Het
Cfi A G 3: 129,874,930 D535G probably damaging Het
Dgat1 T A 15: 76,503,393 Q308H possibly damaging Het
Dsp T C 13: 38,193,342 I1701T possibly damaging Het
E330009J07Rik T C 6: 40,435,992 E45G probably benign Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Fes G C 7: 80,387,167 S56R possibly damaging Het
Gria1 G A 11: 57,289,434 V737M probably damaging Het
Gtf2h1 A G 7: 46,803,895 H84R probably damaging Het
Il15 T A 8: 82,344,420 N22I probably damaging Het
Me1 A G 9: 86,611,912 S323P probably benign Het
Olfr713 T C 7: 107,036,362 F69S possibly damaging Het
Parp4 T C 14: 56,595,416 probably null Het
Pcdhga7 A G 18: 37,715,638 T233A probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rpe65 G T 3: 159,604,563 V128F possibly damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Tbc1d32 A G 10: 56,173,915 V509A probably benign Het
Tln1 T A 4: 43,542,525 T1428S probably benign Het
Ttc27 A T 17: 74,840,459 I669F probably benign Het
Tubb3 T G 8: 123,421,236 C303G probably damaging Het
Tulp2 G T 7: 45,518,763 V188L probably damaging Het
Zfr T C 15: 12,166,163 Y840H probably damaging Het
Other mutations in Ifi208
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Ifi208 APN 1 173679038 critical splice donor site probably null
IGL00725:Ifi208 APN 1 173682861 missense possibly damaging 0.86
IGL01952:Ifi208 APN 1 173679031 missense possibly damaging 0.93
IGL02024:Ifi208 APN 1 173683290 missense probably damaging 0.99
IGL02637:Ifi208 APN 1 173678942 missense probably benign 0.15
IGL02829:Ifi208 APN 1 173682840 missense probably damaging 0.99
IGL03216:Ifi208 APN 1 173678941 missense possibly damaging 0.68
IGL03398:Ifi208 APN 1 173683251 missense probably damaging 0.96
FR4304:Ifi208 UTSW 1 173677698 small deletion probably benign
FR4340:Ifi208 UTSW 1 173677698 small deletion probably benign
FR4342:Ifi208 UTSW 1 173677698 small deletion probably benign
R0022:Ifi208 UTSW 1 173683046 missense possibly damaging 0.91
R0468:Ifi208 UTSW 1 173683481 missense probably benign 0.08
R0734:Ifi208 UTSW 1 173683335 missense probably damaging 0.98
R0780:Ifi208 UTSW 1 173682696 missense probably benign 0.06
R1070:Ifi208 UTSW 1 173683044 missense probably damaging 0.99
R1339:Ifi208 UTSW 1 173683238 missense probably damaging 0.99
R1473:Ifi208 UTSW 1 173695654 missense possibly damaging 0.53
R1755:Ifi208 UTSW 1 173677910 missense possibly damaging 0.86
R3692:Ifi208 UTSW 1 173682872 missense possibly damaging 0.93
R4175:Ifi208 UTSW 1 173682701 missense probably benign 0.01
R4235:Ifi208 UTSW 1 173682911 missense probably benign 0.06
R4749:Ifi208 UTSW 1 173695614 missense possibly damaging 0.70
R4815:Ifi208 UTSW 1 173682837 missense probably damaging 0.96
R5116:Ifi208 UTSW 1 173677983 intron probably benign
R5138:Ifi208 UTSW 1 173690673 missense probably null 0.29
R5210:Ifi208 UTSW 1 173683265 missense probably benign
R5304:Ifi208 UTSW 1 173683608 missense probably benign
R6126:Ifi208 UTSW 1 173677708 missense possibly damaging 0.91
R6558:Ifi208 UTSW 1 173683023 missense probably damaging 0.99
R6915:Ifi208 UTSW 1 173682878 missense probably damaging 1.00
R7513:Ifi208 UTSW 1 173695654 nonsense probably null
R7972:Ifi208 UTSW 1 173678990 missense possibly damaging 0.68
R8143:Ifi208 UTSW 1 173682676 missense possibly damaging 0.91
R8383:Ifi208 UTSW 1 173683509 missense possibly damaging 0.93
R8431:Ifi208 UTSW 1 173683278 missense possibly damaging 0.85
RF027:Ifi208 UTSW 1 173677696 small deletion probably benign
RF029:Ifi208 UTSW 1 173677696 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CAGCTTGATAGGGTGAGAGCTG -3'
(R):5'- AAGAAATGGTGGCTTGGGTATGTAA -3'

Sequencing Primer
(F):5'- GGGTGAGAGCTGCTAATCAATTTTAC -3'
(R):5'- GCTTGGGTATGTAAGCCCAAAAACTC -3'
Posted On2015-01-11