Incidental Mutation 'R3012:Rpe65'
ID 257528
Institutional Source Beutler Lab
Gene Symbol Rpe65
Ensembl Gene ENSMUSG00000028174
Gene Name retinal pigment epithelium 65
Synonyms A930029L06Rik, Mord1, rd12
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock # R3012 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 159599175-159625321 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 159604563 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 128 (V128F)
Ref Sequence ENSEMBL: ENSMUSP00000143654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999] [ENSMUST00000197771]
AlphaFold Q91ZQ5
Predicted Effect possibly damaging
Transcript: ENSMUST00000029824
AA Change: V128F

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174
AA Change: V128F

DomainStartEndE-ValueType
Pfam:RPE65 15 532 1.4e-111 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000196999
AA Change: V128F

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174
AA Change: V128F

DomainStartEndE-ValueType
Pfam:RPE65 15 532 1.4e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197771
SMART Domains Protein: ENSMUSP00000143390
Gene: ENSMUSG00000028174

DomainStartEndE-ValueType
Pfam:RPE65 13 109 5.8e-19 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh18a1 G T 19: 40,557,691 Y585* probably null Het
Ankrd17 G A 5: 90,230,868 P2563S probably damaging Het
Atg10 A T 13: 91,154,278 F47Y probably damaging Het
Ccdc39 C T 3: 33,814,668 R798Q probably damaging Het
Cfi A G 3: 129,874,930 D535G probably damaging Het
Dgat1 T A 15: 76,503,393 Q308H possibly damaging Het
Dsp T C 13: 38,193,342 I1701T possibly damaging Het
E330009J07Rik T C 6: 40,435,992 E45G probably benign Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Fes G C 7: 80,387,167 S56R possibly damaging Het
Gria1 G A 11: 57,289,434 V737M probably damaging Het
Gtf2h1 A G 7: 46,803,895 H84R probably damaging Het
Ifi208 A G 1: 173,695,570 probably null Het
Il15 T A 8: 82,344,420 N22I probably damaging Het
Me1 A G 9: 86,611,912 S323P probably benign Het
Olfr713 T C 7: 107,036,362 F69S possibly damaging Het
Parp4 T C 14: 56,595,416 probably null Het
Pcdhga7 A G 18: 37,715,638 T233A probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Tbc1d32 A G 10: 56,173,915 V509A probably benign Het
Tln1 T A 4: 43,542,525 T1428S probably benign Het
Ttc27 A T 17: 74,840,459 I669F probably benign Het
Tubb3 T G 8: 123,421,236 C303G probably damaging Het
Tulp2 G T 7: 45,518,763 V188L probably damaging Het
Zfr T C 15: 12,166,163 Y840H probably damaging Het
Other mutations in Rpe65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Rpe65 APN 3 159614542 missense probably damaging 0.99
IGL01446:Rpe65 APN 3 159600405 splice site probably benign
IGL01815:Rpe65 APN 3 159604530 splice site probably null
IGL02085:Rpe65 APN 3 159615646 missense probably benign 0.00
IGL02232:Rpe65 APN 3 159604351 missense possibly damaging 0.93
IGL02248:Rpe65 APN 3 159624705 missense probably damaging 1.00
IGL02645:Rpe65 APN 3 159606491 missense probably damaging 0.99
IGL02711:Rpe65 APN 3 159622877 missense possibly damaging 0.84
IGL02982:Rpe65 APN 3 159600361 missense probably damaging 0.99
IGL03280:Rpe65 APN 3 159604341 missense probably damaging 0.96
IGL03350:Rpe65 APN 3 159614517 missense possibly damaging 0.75
IGL03356:Rpe65 APN 3 159615577 missense possibly damaging 0.89
I1329:Rpe65 UTSW 3 159624723 missense probably benign 0.35
R0571:Rpe65 UTSW 3 159600349 missense probably damaging 1.00
R0905:Rpe65 UTSW 3 159601583 missense possibly damaging 0.95
R1024:Rpe65 UTSW 3 159606485 missense probably benign 0.07
R1597:Rpe65 UTSW 3 159614784 missense probably damaging 0.97
R1657:Rpe65 UTSW 3 159614448 missense probably damaging 0.97
R1778:Rpe65 UTSW 3 159622848 missense probably damaging 1.00
R1970:Rpe65 UTSW 3 159615670 missense probably benign
R2259:Rpe65 UTSW 3 159615571 missense probably damaging 1.00
R3923:Rpe65 UTSW 3 159604400 missense probably benign 0.16
R3975:Rpe65 UTSW 3 159604585 missense probably damaging 1.00
R4204:Rpe65 UTSW 3 159604410 missense probably damaging 0.99
R4825:Rpe65 UTSW 3 159624681 missense probably benign
R4924:Rpe65 UTSW 3 159622631 missense probably benign 0.01
R5269:Rpe65 UTSW 3 159604347 missense probably benign 0.07
R5324:Rpe65 UTSW 3 159604404 missense possibly damaging 0.94
R5441:Rpe65 UTSW 3 159604401 missense probably damaging 1.00
R5854:Rpe65 UTSW 3 159615676 missense probably benign
R5907:Rpe65 UTSW 3 159615682 critical splice donor site probably null
R6149:Rpe65 UTSW 3 159614143 missense probably benign
R6660:Rpe65 UTSW 3 159614708 missense probably damaging 0.98
R6830:Rpe65 UTSW 3 159614168 missense probably benign 0.06
R7025:Rpe65 UTSW 3 159622685 missense probably damaging 1.00
R7092:Rpe65 UTSW 3 159615591 missense probably damaging 1.00
R7203:Rpe65 UTSW 3 159622854 missense probably damaging 0.99
R7366:Rpe65 UTSW 3 159624729 missense probably benign 0.13
R7537:Rpe65 UTSW 3 159604609 missense probably damaging 0.98
R7679:Rpe65 UTSW 3 159604393 missense probably damaging 1.00
R8044:Rpe65 UTSW 3 159614705 missense probably benign
R8179:Rpe65 UTSW 3 159624699 missense probably benign 0.06
R8409:Rpe65 UTSW 3 159614148 missense probably benign 0.01
R8558:Rpe65 UTSW 3 159614792 missense probably damaging 1.00
R9042:Rpe65 UTSW 3 159615655 missense probably damaging 1.00
R9483:Rpe65 UTSW 3 159622681 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAACAGAATTTGGCACCTGTG -3'
(R):5'- TTGGGGACTAGCAAGGAGTC -3'

Sequencing Primer
(F):5'- GTGCTTTCCCAGACCCCTG -3'
(R):5'- ACTCATCTGTTCTGTCAAATTTATCC -3'
Posted On 2015-01-11