Incidental Mutation 'R3012:E330009J07Rik'
ID257531
Institutional Source Beutler Lab
Gene Symbol E330009J07Rik
Ensembl Gene ENSMUSG00000037172
Gene NameRIKEN cDNA E330009J07 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R3012 (G1)
Quality Score160
Status Not validated
Chromosome6
Chromosomal Location40401375-40436135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40435992 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 45 (E45G)
Ref Sequence ENSEMBL: ENSMUSP00000099031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039008] [ENSMUST00000101492] [ENSMUST00000201712] [ENSMUST00000202464]
Predicted Effect probably benign
Transcript: ENSMUST00000039008
AA Change: E45G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045103
Gene: ENSMUSG00000037172
AA Change: E45G

DomainStartEndE-ValueType
low complexity region 30 60 N/A INTRINSIC
Pfam:DUF2347 80 347 3.4e-79 PFAM
Pfam:SPA 234 345 5.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101492
AA Change: E45G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099031
Gene: ENSMUSG00000037172
AA Change: E45G

DomainStartEndE-ValueType
low complexity region 30 60 N/A INTRINSIC
Pfam:DUF2347 80 347 3.2e-78 PFAM
Pfam:SPA 234 345 6.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200994
Predicted Effect probably benign
Transcript: ENSMUST00000201712
SMART Domains Protein: ENSMUSP00000143916
Gene: ENSMUSG00000037172

DomainStartEndE-ValueType
Pfam:DUF2347 15 133 1.4e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202464
SMART Domains Protein: ENSMUSP00000144628
Gene: ENSMUSG00000037159

DomainStartEndE-ValueType
low complexity region 117 128 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh18a1 G T 19: 40,557,691 Y585* probably null Het
Ankrd17 G A 5: 90,230,868 P2563S probably damaging Het
Atg10 A T 13: 91,154,278 F47Y probably damaging Het
Ccdc39 C T 3: 33,814,668 R798Q probably damaging Het
Cfi A G 3: 129,874,930 D535G probably damaging Het
Dgat1 T A 15: 76,503,393 Q308H possibly damaging Het
Dsp T C 13: 38,193,342 I1701T possibly damaging Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Fes G C 7: 80,387,167 S56R possibly damaging Het
Gria1 G A 11: 57,289,434 V737M probably damaging Het
Gtf2h1 A G 7: 46,803,895 H84R probably damaging Het
Ifi208 A G 1: 173,695,570 probably null Het
Il15 T A 8: 82,344,420 N22I probably damaging Het
Me1 A G 9: 86,611,912 S323P probably benign Het
Olfr713 T C 7: 107,036,362 F69S possibly damaging Het
Parp4 T C 14: 56,595,416 probably null Het
Pcdhga7 A G 18: 37,715,638 T233A probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rpe65 G T 3: 159,604,563 V128F possibly damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Tbc1d32 A G 10: 56,173,915 V509A probably benign Het
Tln1 T A 4: 43,542,525 T1428S probably benign Het
Ttc27 A T 17: 74,840,459 I669F probably benign Het
Tubb3 T G 8: 123,421,236 C303G probably damaging Het
Tulp2 G T 7: 45,518,763 V188L probably damaging Het
Zfr T C 15: 12,166,163 Y840H probably damaging Het
Other mutations in E330009J07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02813:E330009J07Rik APN 6 40418539 missense probably benign 0.00
IGL03143:E330009J07Rik APN 6 40422894 splice site probably benign
R1812:E330009J07Rik UTSW 6 40409431 missense probably benign 0.02
R1928:E330009J07Rik UTSW 6 40411714 missense probably benign 0.14
R2443:E330009J07Rik UTSW 6 40406776 missense probably damaging 0.99
R6913:E330009J07Rik UTSW 6 40406917 missense possibly damaging 0.91
R7318:E330009J07Rik UTSW 6 40409164 missense possibly damaging 0.72
R7456:E330009J07Rik UTSW 6 40406840 missense probably benign 0.33
R8087:E330009J07Rik UTSW 6 40418592 missense possibly damaging 0.94
R8231:E330009J07Rik UTSW 6 40418612 missense probably benign 0.35
Y4340:E330009J07Rik UTSW 6 40436058 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAACCCAGTGTGCAGTCTCC -3'
(R):5'- CCCTACACTATGGATCAAGAGC -3'

Sequencing Primer
(F):5'- AGTGTGCAGTCTCCCCCAC -3'
(R):5'- CCACATACAGAGATGCAGAGCTG -3'
Posted On2015-01-11