Incidental Mutation 'R3012:Tulp2'
ID 257532
Institutional Source Beutler Lab
Gene Symbol Tulp2
Ensembl Gene ENSMUSG00000023467
Gene Name tubby-like protein 2
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.097) question?
Stock # R3012 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 45131450-45173070 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 45168187 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 188 (V188L)
Ref Sequence ENSEMBL: ENSMUSP00000082438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024233] [ENSMUST00000042105] [ENSMUST00000085331] [ENSMUST00000107758] [ENSMUST00000107759] [ENSMUST00000107762] [ENSMUST00000210868] [ENSMUST00000210813] [ENSMUST00000210532] [ENSMUST00000209763] [ENSMUST00000210299] [ENSMUST00000211212] [ENSMUST00000167273]
AlphaFold P46686
Predicted Effect probably damaging
Transcript: ENSMUST00000024233
AA Change: V312L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024233
Gene: ENSMUSG00000023467
AA Change: V312L

DomainStartEndE-ValueType
low complexity region 67 77 N/A INTRINSIC
low complexity region 212 220 N/A INTRINSIC
Pfam:Tub 315 556 1.1e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042105
SMART Domains Protein: ENSMUSP00000049488
Gene: ENSMUSG00000040435

DomainStartEndE-ValueType
low complexity region 149 160 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
internal_repeat_1 245 333 1.03e-15 PROSPERO
low complexity region 334 351 N/A INTRINSIC
internal_repeat_1 357 447 1.03e-15 PROSPERO
low complexity region 448 459 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
Pfam:PP1c_bdg 536 612 8.2e-15 PFAM
low complexity region 636 652 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085331
AA Change: V188L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082438
Gene: ENSMUSG00000023467
AA Change: V188L

DomainStartEndE-ValueType
low complexity region 88 96 N/A INTRINSIC
Pfam:Tub 191 432 6.2e-117 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107758
AA Change: V200L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103387
Gene: ENSMUSG00000023467
AA Change: V200L

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 451 4.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107759
AA Change: V200L

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103388
Gene: ENSMUSG00000023467
AA Change: V200L

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 444 3.4e-117 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107760
AA Change: V200L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103389
Gene: ENSMUSG00000023467
AA Change: V200L

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 451 1.5e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107762
AA Change: V312L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103391
Gene: ENSMUSG00000023467
AA Change: V312L

DomainStartEndE-ValueType
Pfam:Tub_N 39 295 8.8e-36 PFAM
Pfam:Tub 315 556 1.3e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107761
AA Change: V200L

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103390
Gene: ENSMUSG00000023467
AA Change: V200L

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 444 3.4e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210868
AA Change: V200L

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably damaging
Transcript: ENSMUST00000210813
AA Change: V200L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000210532
Predicted Effect probably benign
Transcript: ENSMUST00000209763
Predicted Effect probably benign
Transcript: ENSMUST00000210299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211413
Predicted Effect probably benign
Transcript: ENSMUST00000211212
Predicted Effect probably benign
Transcript: ENSMUST00000167273
SMART Domains Protein: ENSMUSP00000128497
Gene: ENSMUSG00000040435

DomainStartEndE-ValueType
low complexity region 149 160 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
internal_repeat_1 245 333 1.03e-15 PROSPERO
low complexity region 334 351 N/A INTRINSIC
internal_repeat_1 357 447 1.03e-15 PROSPERO
low complexity region 448 459 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
Pfam:PP1c_bdg 531 612 1.1e-20 PFAM
low complexity region 636 652 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TULP2 is a member of a family of tubby-like genes (TULPs) that encode proteins of unknown function. Members of this family have been identified in plants, vertebrates, and invertebrates. The TULP proteins share a conserved C-terminal region of approximately 200 amino acid residues. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh18a1 G T 19: 40,546,135 (GRCm39) Y585* probably null Het
Ankrd17 G A 5: 90,378,727 (GRCm39) P2563S probably damaging Het
Atg10 A T 13: 91,302,397 (GRCm39) F47Y probably damaging Het
Ccdc39 C T 3: 33,868,817 (GRCm39) R798Q probably damaging Het
Cfi A G 3: 129,668,579 (GRCm39) D535G probably damaging Het
Dennd11 T C 6: 40,412,926 (GRCm39) E45G probably benign Het
Dgat1 T A 15: 76,387,593 (GRCm39) Q308H possibly damaging Het
Dsp T C 13: 38,377,318 (GRCm39) I1701T possibly damaging Het
Egr2 GAA GA 10: 67,375,733 (GRCm39) probably null Het
Fes G C 7: 80,036,915 (GRCm39) S56R possibly damaging Het
Gria1 G A 11: 57,180,260 (GRCm39) V737M probably damaging Het
Gtf2h1 A G 7: 46,453,319 (GRCm39) H84R probably damaging Het
Ifi208 A G 1: 173,523,136 (GRCm39) probably null Het
Il15 T A 8: 83,071,049 (GRCm39) N22I probably damaging Het
Me1 A G 9: 86,493,965 (GRCm39) S323P probably benign Het
Or10a5 T C 7: 106,635,569 (GRCm39) F69S possibly damaging Het
Parp4 T C 14: 56,832,873 (GRCm39) probably null Het
Pcdhga7 A G 18: 37,848,691 (GRCm39) T233A probably benign Het
Rab36 G A 10: 74,880,328 (GRCm39) V63I probably damaging Het
Rpe65 G T 3: 159,310,200 (GRCm39) V128F possibly damaging Het
Slc5a11 GGTGC G 7: 122,838,595 (GRCm39) probably null Het
Tbc1d32 A G 10: 56,050,011 (GRCm39) V509A probably benign Het
Tln1 T A 4: 43,542,525 (GRCm39) T1428S probably benign Het
Ttc27 A T 17: 75,147,454 (GRCm39) I669F probably benign Het
Tubb3 T G 8: 124,147,975 (GRCm39) C303G probably damaging Het
Zfr T C 15: 12,166,249 (GRCm39) Y840H probably damaging Het
Other mutations in Tulp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Tulp2 APN 7 45,171,332 (GRCm39) missense probably damaging 1.00
IGL00942:Tulp2 APN 7 45,165,692 (GRCm39) missense possibly damaging 0.87
IGL01881:Tulp2 APN 7 45,170,219 (GRCm39) missense probably damaging 1.00
IGL03240:Tulp2 APN 7 45,171,734 (GRCm39) missense probably damaging 1.00
IGL03242:Tulp2 APN 7 45,171,282 (GRCm39) missense probably damaging 0.99
IGL03353:Tulp2 APN 7 45,165,696 (GRCm39) missense probably damaging 1.00
R0063:Tulp2 UTSW 7 45,170,284 (GRCm39) unclassified probably benign
R0063:Tulp2 UTSW 7 45,170,284 (GRCm39) unclassified probably benign
R0306:Tulp2 UTSW 7 45,168,000 (GRCm39) unclassified probably benign
R0648:Tulp2 UTSW 7 45,169,210 (GRCm39) missense probably damaging 1.00
R0710:Tulp2 UTSW 7 45,170,232 (GRCm39) missense possibly damaging 0.92
R1168:Tulp2 UTSW 7 45,167,266 (GRCm39) missense probably benign
R1345:Tulp2 UTSW 7 45,168,145 (GRCm39) missense probably benign 0.13
R1737:Tulp2 UTSW 7 45,169,201 (GRCm39) missense probably damaging 1.00
R1854:Tulp2 UTSW 7 45,167,367 (GRCm39) missense probably damaging 0.98
R1918:Tulp2 UTSW 7 45,167,365 (GRCm39) missense possibly damaging 0.95
R2356:Tulp2 UTSW 7 45,168,052 (GRCm39) missense possibly damaging 0.85
R3419:Tulp2 UTSW 7 45,168,176 (GRCm39) missense possibly damaging 0.56
R4236:Tulp2 UTSW 7 45,171,298 (GRCm39) missense probably damaging 1.00
R4701:Tulp2 UTSW 7 45,167,348 (GRCm39) missense probably damaging 0.98
R5367:Tulp2 UTSW 7 45,166,075 (GRCm39) missense possibly damaging 0.95
R6056:Tulp2 UTSW 7 45,139,797 (GRCm39) splice site probably null
R6294:Tulp2 UTSW 7 45,164,116 (GRCm39) missense probably damaging 1.00
R6432:Tulp2 UTSW 7 45,168,012 (GRCm39) missense probably benign 0.01
R6875:Tulp2 UTSW 7 45,168,038 (GRCm39) missense probably benign 0.05
R7459:Tulp2 UTSW 7 45,169,227 (GRCm39) missense probably damaging 1.00
R7556:Tulp2 UTSW 7 45,168,005 (GRCm39) splice site probably null
R7676:Tulp2 UTSW 7 45,170,451 (GRCm39) missense possibly damaging 0.86
R7883:Tulp2 UTSW 7 45,166,188 (GRCm39) splice site probably null
R8775:Tulp2 UTSW 7 45,164,914 (GRCm39) missense probably benign
R8775-TAIL:Tulp2 UTSW 7 45,164,914 (GRCm39) missense probably benign
R8804:Tulp2 UTSW 7 45,170,398 (GRCm39) missense probably damaging 1.00
Z1088:Tulp2 UTSW 7 45,171,410 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTTGAATTAGGATGAAGACCG -3'
(R):5'- AGCCATCTTCCTACGATTTGG -3'

Sequencing Primer
(F):5'- TGAATTAGGATGAAGACCGGGAGAAG -3'
(R):5'- CCATCTTCCTACGATTTGGGGTTTG -3'
Posted On 2015-01-11