Incidental Mutation 'R3012:Olfr713'
ID257535
Institutional Source Beutler Lab
Gene Symbol Olfr713
Ensembl Gene ENSMUSG00000073898
Gene Nameolfactory receptor 713
SynonymsGA_x6K02T2PBJ9-9415724-9416677, MOR263-1, P3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R3012 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location107031174-107040994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107036362 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 69 (F69S)
Ref Sequence ENSEMBL: ENSMUSP00000095741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098138] [ENSMUST00000098139] [ENSMUST00000213623]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098138
AA Change: F69S

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095741
Gene: ENSMUSG00000073897
AA Change: F69S

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 2.6e-58 PFAM
Pfam:7tm_1 42 291 2.2e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000098139
AA Change: F76S

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095743
Gene: ENSMUSG00000073898
AA Change: F76S

DomainStartEndE-ValueType
Pfam:7tm_4 39 316 4.4e-57 PFAM
Pfam:7tm_1 49 298 2e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213623
AA Change: F69S

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal olfactory sensory neuron projections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh18a1 G T 19: 40,557,691 Y585* probably null Het
Ankrd17 G A 5: 90,230,868 P2563S probably damaging Het
Atg10 A T 13: 91,154,278 F47Y probably damaging Het
Ccdc39 C T 3: 33,814,668 R798Q probably damaging Het
Cfi A G 3: 129,874,930 D535G probably damaging Het
Dgat1 T A 15: 76,503,393 Q308H possibly damaging Het
Dsp T C 13: 38,193,342 I1701T possibly damaging Het
E330009J07Rik T C 6: 40,435,992 E45G probably benign Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Fes G C 7: 80,387,167 S56R possibly damaging Het
Gria1 G A 11: 57,289,434 V737M probably damaging Het
Gtf2h1 A G 7: 46,803,895 H84R probably damaging Het
Ifi208 A G 1: 173,695,570 probably null Het
Il15 T A 8: 82,344,420 N22I probably damaging Het
Me1 A G 9: 86,611,912 S323P probably benign Het
Parp4 T C 14: 56,595,416 probably null Het
Pcdhga7 A G 18: 37,715,638 T233A probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rpe65 G T 3: 159,604,563 V128F possibly damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Tbc1d32 A G 10: 56,173,915 V509A probably benign Het
Tln1 T A 4: 43,542,525 T1428S probably benign Het
Ttc27 A T 17: 74,840,459 I669F probably benign Het
Tubb3 T G 8: 123,421,236 C303G probably damaging Het
Tulp2 G T 7: 45,518,763 V188L probably damaging Het
Zfr T C 15: 12,166,163 Y840H probably damaging Het
Other mutations in Olfr713
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Olfr713 APN 7 107036847 missense probably damaging 0.99
IGL01630:Olfr713 APN 7 107037111 utr 3 prime probably benign
IGL02539:Olfr713 APN 7 107036434 missense probably damaging 1.00
IGL02727:Olfr713 APN 7 107036695 missense probably damaging 1.00
IGL03336:Olfr713 APN 7 107036335 missense probably damaging 1.00
R0501:Olfr713 UTSW 7 107036232 missense probably benign
R0684:Olfr713 UTSW 7 107036682 missense probably damaging 1.00
R0909:Olfr713 UTSW 7 107036194 missense probably benign 0.19
R1481:Olfr713 UTSW 7 107036149 missense probably benign 0.05
R1958:Olfr713 UTSW 7 107036271 missense possibly damaging 0.77
R1965:Olfr713 UTSW 7 107036358 missense probably damaging 1.00
R2119:Olfr713 UTSW 7 107036731 missense probably damaging 1.00
R2149:Olfr713 UTSW 7 107036338 missense possibly damaging 0.68
R3428:Olfr713 UTSW 7 107036716 missense probably benign
R4425:Olfr713 UTSW 7 107036491 missense probably damaging 1.00
R4795:Olfr713 UTSW 7 107036914 missense probably benign 0.00
R4796:Olfr713 UTSW 7 107036914 missense probably benign 0.00
R4908:Olfr713 UTSW 7 107036157 start codon destroyed probably benign 0.02
R4945:Olfr713 UTSW 7 107036319 missense probably benign 0.00
R5122:Olfr713 UTSW 7 107036848 nonsense probably null
R5721:Olfr713 UTSW 7 107036358 missense probably damaging 1.00
R5979:Olfr713 UTSW 7 107036336 missense probably damaging 1.00
R6739:Olfr713 UTSW 7 107036811 missense probably damaging 1.00
R6981:Olfr713 UTSW 7 107036749 missense possibly damaging 0.77
R7197:Olfr713 UTSW 7 107036157 missense probably benign 0.03
R7228:Olfr713 UTSW 7 107037100 missense probably benign
R7444:Olfr713 UTSW 7 107036347 missense probably damaging 1.00
R8830:Olfr713 UTSW 7 107036682 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TTCCCATGGCTACAGGAAACC -3'
(R):5'- CTGGGTAATGCAAGGGACTG -3'

Sequencing Primer
(F):5'- CATGGCTACAGGAAACCAGACAAG -3'
(R):5'- TGCAGATGGCCACATAGC -3'
Posted On2015-01-11