Incidental Mutation 'R3012:Il15'
ID257537
Institutional Source Beutler Lab
Gene Symbol Il15
Ensembl Gene ENSMUSG00000031712
Gene Nameinterleukin 15
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3012 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location82331632-82403222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82344420 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 22 (N22I)
Ref Sequence ENSEMBL: ENSMUSP00000147312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034148] [ENSMUST00000209363] [ENSMUST00000209573] [ENSMUST00000210094] [ENSMUST00000211565]
Predicted Effect probably damaging
Transcript: ENSMUST00000034148
AA Change: N22I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034148
Gene: ENSMUSG00000031712
AA Change: N22I

DomainStartEndE-ValueType
Pfam:IL15 33 160 8.6e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209363
AA Change: N22I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000209573
AA Change: N22I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209687
Predicted Effect probably damaging
Transcript: ENSMUST00000210094
AA Change: N22I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211282
Predicted Effect probably damaging
Transcript: ENSMUST00000211565
AA Change: N22I

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211722
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a a pleiotropic cytokine of the interleukin family of proteins that plays important roles in the innate and adaptive cell homeostasis, as well as peripheral immune function. The encoded protein undergoes proteolytic processing to generate a mature cytokine that stimulates the proliferation of natural killer cells. The transgenic mice overexpressing the encoded protein exhibit an increase in the number of memory CD8+ T cells in a naive state and enhanced protection against bacterial infections. Mice lacking the encoded protein exhibit impaired protection against a strain of attenuated Mycobacterium. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions of this gene have normal life spans but display a variety of immune system abnormalities and maternal placental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh18a1 G T 19: 40,557,691 Y585* probably null Het
Ankrd17 G A 5: 90,230,868 P2563S probably damaging Het
Atg10 A T 13: 91,154,278 F47Y probably damaging Het
Ccdc39 C T 3: 33,814,668 R798Q probably damaging Het
Cfi A G 3: 129,874,930 D535G probably damaging Het
Dgat1 T A 15: 76,503,393 Q308H possibly damaging Het
Dsp T C 13: 38,193,342 I1701T possibly damaging Het
E330009J07Rik T C 6: 40,435,992 E45G probably benign Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Fes G C 7: 80,387,167 S56R possibly damaging Het
Gria1 G A 11: 57,289,434 V737M probably damaging Het
Gtf2h1 A G 7: 46,803,895 H84R probably damaging Het
Ifi208 A G 1: 173,695,570 probably null Het
Me1 A G 9: 86,611,912 S323P probably benign Het
Olfr713 T C 7: 107,036,362 F69S possibly damaging Het
Parp4 T C 14: 56,595,416 probably null Het
Pcdhga7 A G 18: 37,715,638 T233A probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rpe65 G T 3: 159,604,563 V128F possibly damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Tbc1d32 A G 10: 56,173,915 V509A probably benign Het
Tln1 T A 4: 43,542,525 T1428S probably benign Het
Ttc27 A T 17: 74,840,459 I669F probably benign Het
Tubb3 T G 8: 123,421,236 C303G probably damaging Het
Tulp2 G T 7: 45,518,763 V188L probably damaging Het
Zfr T C 15: 12,166,163 Y840H probably damaging Het
Other mutations in Il15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02590:Il15 APN 8 82343283 missense probably benign
R0306:Il15 UTSW 8 82334454 splice site probably benign
R0638:Il15 UTSW 8 82343261 missense probably damaging 0.99
R0685:Il15 UTSW 8 82337559 splice site probably benign
R7089:Il15 UTSW 8 82337575 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTAAGGATTTGCACGTCCCC -3'
(R):5'- GAGCCACTGAAATTTCACTGTTTCC -3'

Sequencing Primer
(F):5'- CCTGATATCCTACGCTGAAGAGTG -3'
(R):5'- GATTGTGAAATGACACCTTTAC -3'
Posted On2015-01-11