Mutagenetix > Incidental Mutation

Incidental Mutation 'R3012:Egr2'

257541

Institutional Source

Beutler Lab

Gene Symbol

Egr2

Ensembl Gene

ENSMUSG00000037868

Gene Name

early growth response 2

Synonyms

Zfp-25, Egr-2, Krox-20, Krox20, NGF1-B

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3012 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

67535475-67542188 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

GAA to GA at 67539903 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000118941 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048289] [ENSMUST00000075686] [ENSMUST00000105438] [ENSMUST00000127820] [ENSMUST00000130933] [ENSMUST00000145754] [ENSMUST00000145936] [ENSMUST00000146986]

AlphaFold

P08152

Predicted Effect

probably null
Transcript: ENSMUST00000048289
AA Change: 110

SMART Domains

Protein: ENSMUSP00000041053
Gene: ENSMUSG00000037868
AA Change: 110

Domain	Start	End	E-Value	Type
Pfam:DUF3446	94	184	2.5e-26	PFAM
low complexity region	190	217	N/A	INTRINSIC
low complexity region	272	298	N/A	INTRINSIC
low complexity region	312	321	N/A	INTRINSIC
ZnF_C2H2	337	361	1.06e-4	SMART
ZnF_C2H2	367	389	2.91e-2	SMART
ZnF_C2H2	395	417	1.45e-2	SMART
low complexity region	425	449	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000075686

SMART Domains

Protein: ENSMUSP00000075107
Gene: ENSMUSG00000057134

Domain	Start	End	E-Value	Type
Pfam:DUF1637	45	254	2.7e-68	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000105438

SMART Domains

Protein: ENSMUSP00000101078
Gene: ENSMUSG00000037868

Domain	Start	End	E-Value	Type
Pfam:DUF3446	44	134	1.3e-27	PFAM
low complexity region	140	167	N/A	INTRINSIC
low complexity region	222	248	N/A	INTRINSIC
low complexity region	262	271	N/A	INTRINSIC
ZnF_C2H2	287	311	1.06e-4	SMART
ZnF_C2H2	317	339	2.91e-2	SMART
ZnF_C2H2	345	367	1.45e-2	SMART
low complexity region	375	399	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000127820

SMART Domains

Protein: ENSMUSP00000116799
Gene: ENSMUSG00000037868

Domain	Start	End	E-Value	Type
Pfam:DUF3446	36	126	1.3e-27	PFAM
low complexity region	132	159	N/A	INTRINSIC
low complexity region	214	240	N/A	INTRINSIC
low complexity region	254	263	N/A	INTRINSIC
ZnF_C2H2	279	303	1.06e-4	SMART
ZnF_C2H2	309	331	2.91e-2	SMART
ZnF_C2H2	337	359	1.45e-2	SMART
low complexity region	367	391	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130933

Predicted Effect

probably null
Transcript: ENSMUST00000145754

SMART Domains

Protein: ENSMUSP00000116621
Gene: ENSMUSG00000037868

Domain	Start	End	E-Value	Type
Pfam:DUF3446	107	197	4.4e-28	PFAM
low complexity region	203	230	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000145936

SMART Domains

Protein: ENSMUSP00000115709
Gene: ENSMUSG00000037868

Domain	Start	End	E-Value	Type
Pfam:DUF3446	107	197	3.7e-29	PFAM
low complexity region	203	230	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000146986

SMART Domains

Protein: ENSMUSP00000118941
Gene: ENSMUSG00000037868

Domain	Start	End	E-Value	Type
Pfam:DUF3446	44	72	7.5e-11	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor with three tandem C2H2-type zinc fingers. Defects in this gene are associated with Charcot-Marie-Tooth disease type 1D (CMT1D), Charcot-Marie-Tooth disease type 4E (CMT4E), and with Dejerine-Sottas syndrome (DSS). Multiple transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit absence of rhombomeres 3 and 5 of the hindbrain affecting axonal migration, disrupted myelination of Schwann cells, slow respiratory and jaw opening rhythms, skeletal abnormalities, and perinatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh18a1	G	T	19: 40,557,691	Y585*	probably null	Het
Ankrd17	G	A	5: 90,230,868	P2563S	probably damaging	Het
Atg10	A	T	13: 91,154,278	F47Y	probably damaging	Het
Ccdc39	C	T	3: 33,814,668	R798Q	probably damaging	Het
Cfi	A	G	3: 129,874,930	D535G	probably damaging	Het
Dgat1	T	A	15: 76,503,393	Q308H	possibly damaging	Het
Dsp	T	C	13: 38,193,342	I1701T	possibly damaging	Het
E330009J07Rik	T	C	6: 40,435,992	E45G	probably benign	Het
Fes	G	C	7: 80,387,167	S56R	possibly damaging	Het
Gria1	G	A	11: 57,289,434	V737M	probably damaging	Het
Gtf2h1	A	G	7: 46,803,895	H84R	probably damaging	Het
Ifi208	A	G	1: 173,695,570		probably null	Het
Il15	T	A	8: 82,344,420	N22I	probably damaging	Het
Me1	A	G	9: 86,611,912	S323P	probably benign	Het
Olfr713	T	C	7: 107,036,362	F69S	possibly damaging	Het
Parp4	T	C	14: 56,595,416		probably null	Het
Pcdhga7	A	G	18: 37,715,638	T233A	probably benign	Het
Rab36	G	A	10: 75,044,496	V63I	probably damaging	Het
Rpe65	G	T	3: 159,604,563	V128F	possibly damaging	Het
Slc5a11	GGTGC	G	7: 123,239,372		probably null	Het
Tbc1d32	A	G	10: 56,173,915	V509A	probably benign	Het
Tln1	T	A	4: 43,542,525	T1428S	probably benign	Het
Ttc27	A	T	17: 74,840,459	I669F	probably benign	Het
Tubb3	T	G	8: 123,421,236	C303G	probably damaging	Het
Tulp2	G	T	7: 45,518,763	V188L	probably damaging	Het
Zfr	T	C	15: 12,166,163	Y840H	probably damaging	Het

Other mutations in Egr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01921:Egr2	APN	10	67540378	splice site	probably null
IGL01933:Egr2	APN	10	67540194	missense	probably damaging	0.99
IGL02093:Egr2	APN	10	67540024	missense	probably damaging	1.00
Puyol	UTSW	10	67539903	frame shift	probably null
R0045:Egr2	UTSW	10	67540480	missense	probably benign	0.01
R1572:Egr2	UTSW	10	67539975	missense	probably damaging	1.00
R1992:Egr2	UTSW	10	67540027	missense	probably damaging	0.99
R2139:Egr2	UTSW	10	67540872	missense	probably damaging	0.99
R4454:Egr2	UTSW	10	67539903	frame shift	probably null
R4455:Egr2	UTSW	10	67539903	frame shift	probably null
R4458:Egr2	UTSW	10	67539903	frame shift	probably null
R4462:Egr2	UTSW	10	67539903	frame shift	probably null
R4903:Egr2	UTSW	10	67538333	missense	probably damaging	1.00
R5133:Egr2	UTSW	10	67539775	missense	probably damaging	0.99
R5566:Egr2	UTSW	10	67540766	nonsense	probably null
R8462:Egr2	UTSW	10	67538343	missense	probably null	0.99
R9435:Egr2	UTSW	10	67539798	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGTCAGCATGCGTGTATGTG -3'
(R):5'- TAGAGGTGGTCCAGTTCAGG -3'

Sequencing Primer
(F):5'- CAGCATGCGTGTATGTGAATTAG -3'
(R):5'- GTCCAGTTCAGGCTGAGTC -3'

Posted On

2015-01-11