Incidental Mutation 'R3012:Rab36'
ID257542
Institutional Source Beutler Lab
Gene Symbol Rab36
Ensembl Gene ENSMUSG00000020175
Gene NameRAB36, member RAS oncogene family
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3012 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location75037058-75054748 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75044496 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 63 (V63I)
Ref Sequence ENSEMBL: ENSMUSP00000119399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020391] [ENSMUST00000139384] [ENSMUST00000146440] [ENSMUST00000147802]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020391
AA Change: V63I

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020391
Gene: ENSMUSG00000020175
AA Change: V63I

DomainStartEndE-ValueType
RAB 59 224 6.4e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136944
Predicted Effect probably damaging
Transcript: ENSMUST00000139384
AA Change: V63I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118718
Gene: ENSMUSG00000020175
AA Change: V63I

DomainStartEndE-ValueType
Pfam:Arf 42 134 6.3e-8 PFAM
Pfam:Ras 74 134 1.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142507
Predicted Effect probably damaging
Transcript: ENSMUST00000146440
AA Change: V63I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121693
Gene: ENSMUSG00000020175
AA Change: V63I

DomainStartEndE-ValueType
RAB 59 224 6.4e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147802
AA Change: V63I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119399
Gene: ENSMUSG00000020175
AA Change: V63I

DomainStartEndE-ValueType
RAB 59 224 6.4e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151432
Meta Mutation Damage Score 0.2092 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh18a1 G T 19: 40,557,691 Y585* probably null Het
Ankrd17 G A 5: 90,230,868 P2563S probably damaging Het
Atg10 A T 13: 91,154,278 F47Y probably damaging Het
Ccdc39 C T 3: 33,814,668 R798Q probably damaging Het
Cfi A G 3: 129,874,930 D535G probably damaging Het
Dgat1 T A 15: 76,503,393 Q308H possibly damaging Het
Dsp T C 13: 38,193,342 I1701T possibly damaging Het
E330009J07Rik T C 6: 40,435,992 E45G probably benign Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Fes G C 7: 80,387,167 S56R possibly damaging Het
Gria1 G A 11: 57,289,434 V737M probably damaging Het
Gtf2h1 A G 7: 46,803,895 H84R probably damaging Het
Ifi208 A G 1: 173,695,570 probably null Het
Il15 T A 8: 82,344,420 N22I probably damaging Het
Me1 A G 9: 86,611,912 S323P probably benign Het
Olfr713 T C 7: 107,036,362 F69S possibly damaging Het
Parp4 T C 14: 56,595,416 probably null Het
Pcdhga7 A G 18: 37,715,638 T233A probably benign Het
Rpe65 G T 3: 159,604,563 V128F possibly damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Tbc1d32 A G 10: 56,173,915 V509A probably benign Het
Tln1 T A 4: 43,542,525 T1428S probably benign Het
Ttc27 A T 17: 74,840,459 I669F probably benign Het
Tubb3 T G 8: 123,421,236 C303G probably damaging Het
Tulp2 G T 7: 45,518,763 V188L probably damaging Het
Zfr T C 15: 12,166,163 Y840H probably damaging Het
Other mutations in Rab36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Rab36 APN 10 75048466 missense probably damaging 1.00
IGL01554:Rab36 APN 10 75050688 missense possibly damaging 0.50
IGL02197:Rab36 APN 10 75052042 missense probably damaging 0.96
R2022:Rab36 UTSW 10 75052474 missense probably benign 0.13
R2907:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R2991:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3033:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3034:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3035:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3036:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3440:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3686:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3687:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3688:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4398:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4426:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4427:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4433:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4456:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4457:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4467:Rab36 UTSW 10 75052043 nonsense probably null
R4689:Rab36 UTSW 10 75041933 critical splice donor site probably null
R5043:Rab36 UTSW 10 75051005 missense probably benign 0.00
R5568:Rab36 UTSW 10 75052479 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATGACATTGGCCAAAGGGG -3'
(R):5'- GCCTTTACCACACCCTTCAA -3'

Sequencing Primer
(F):5'- GGAGTGTATGTTCTCCCATATCCCAG -3'
(R):5'- AAACTGTTTCCCAGGCTCAGG -3'
Posted On2015-01-11