Incidental Mutation 'R3012:Dsp'
ID 257544
Institutional Source Beutler Lab
Gene Symbol Dsp
Ensembl Gene ENSMUSG00000054889
Gene Name desmoplakin
Synonyms DP, 2300002E22Rik, 5730453H04Rik, rul
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3012 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 38335270-38382553 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38377318 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 1701 (I1701T)
Ref Sequence ENSEMBL: ENSMUSP00000115062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000124830
AA Change: I1701T

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: I1701T

DomainStartEndE-ValueType
Blast:SPEC 193 282 2e-51 BLAST
SPEC 285 385 6.03e-2 SMART
Blast:SPEC 391 557 1e-96 BLAST
Blast:SPEC 783 894 4e-34 BLAST
SPEC 901 1030 1.39e0 SMART
coiled coil region 1033 1370 N/A INTRINSIC
coiled coil region 1394 1956 N/A INTRINSIC
low complexity region 1997 2011 N/A INTRINSIC
PLEC 2021 2057 3.33e-1 SMART
PLEC 2058 2095 3.76e-9 SMART
PLEC 2096 2133 4.09e-10 SMART
PLEC 2134 2171 2.09e-7 SMART
PLEC 2175 2209 4.83e1 SMART
PLEC 2210 2245 5.67e1 SMART
PLEC 2263 2300 1.22e-8 SMART
PLEC 2301 2338 1.16e-9 SMART
PLEC 2339 2376 1.12e-7 SMART
PLEC 2377 2414 1.56e-6 SMART
PLEC 2418 2452 1.42e0 SMART
PLEC 2468 2505 3.7e-8 SMART
low complexity region 2507 2517 N/A INTRINSIC
PLEC 2519 2556 3.73e-4 SMART
low complexity region 2577 2593 N/A INTRINSIC
PLEC 2622 2659 1.46e-6 SMART
PLEC 2660 2697 6.69e-15 SMART
PLEC 2698 2735 1.98e2 SMART
PLEC 2736 2773 2.35e-10 SMART
PLEC 2774 2811 1.39e-3 SMART
low complexity region 2835 2860 N/A INTRINSIC
low complexity region 2867 2879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127906
SMART Domains Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889

DomainStartEndE-ValueType
Blast:SPEC 193 282 2e-51 BLAST
SPEC 285 385 6.03e-2 SMART
Blast:SPEC 391 557 1e-95 BLAST
Blast:SPEC 783 894 3e-34 BLAST
SPEC 901 1030 1.39e0 SMART
coiled coil region 1033 1357 N/A INTRINSIC
low complexity region 1398 1412 N/A INTRINSIC
PLEC 1422 1458 3.33e-1 SMART
PLEC 1459 1496 3.76e-9 SMART
PLEC 1497 1534 4.09e-10 SMART
PLEC 1535 1572 2.09e-7 SMART
PLEC 1576 1610 4.83e1 SMART
PLEC 1611 1646 5.67e1 SMART
PLEC 1664 1701 1.22e-8 SMART
PLEC 1702 1739 1.16e-9 SMART
PLEC 1740 1777 1.12e-7 SMART
PLEC 1778 1815 1.56e-6 SMART
PLEC 1819 1853 1.42e0 SMART
PLEC 1869 1906 3.7e-8 SMART
low complexity region 1908 1918 N/A INTRINSIC
PLEC 1920 1957 3.73e-4 SMART
low complexity region 1978 1994 N/A INTRINSIC
PLEC 2023 2060 1.46e-6 SMART
PLEC 2061 2098 6.69e-15 SMART
PLEC 2099 2136 1.98e2 SMART
PLEC 2137 2174 2.35e-10 SMART
PLEC 2175 2212 1.39e-3 SMART
low complexity region 2236 2261 N/A INTRINSIC
low complexity region 2268 2280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh18a1 G T 19: 40,546,135 (GRCm39) Y585* probably null Het
Ankrd17 G A 5: 90,378,727 (GRCm39) P2563S probably damaging Het
Atg10 A T 13: 91,302,397 (GRCm39) F47Y probably damaging Het
Ccdc39 C T 3: 33,868,817 (GRCm39) R798Q probably damaging Het
Cfi A G 3: 129,668,579 (GRCm39) D535G probably damaging Het
Dennd11 T C 6: 40,412,926 (GRCm39) E45G probably benign Het
Dgat1 T A 15: 76,387,593 (GRCm39) Q308H possibly damaging Het
Egr2 GAA GA 10: 67,375,733 (GRCm39) probably null Het
Fes G C 7: 80,036,915 (GRCm39) S56R possibly damaging Het
Gria1 G A 11: 57,180,260 (GRCm39) V737M probably damaging Het
Gtf2h1 A G 7: 46,453,319 (GRCm39) H84R probably damaging Het
Ifi208 A G 1: 173,523,136 (GRCm39) probably null Het
Il15 T A 8: 83,071,049 (GRCm39) N22I probably damaging Het
Me1 A G 9: 86,493,965 (GRCm39) S323P probably benign Het
Or10a5 T C 7: 106,635,569 (GRCm39) F69S possibly damaging Het
Parp4 T C 14: 56,832,873 (GRCm39) probably null Het
Pcdhga7 A G 18: 37,848,691 (GRCm39) T233A probably benign Het
Rab36 G A 10: 74,880,328 (GRCm39) V63I probably damaging Het
Rpe65 G T 3: 159,310,200 (GRCm39) V128F possibly damaging Het
Slc5a11 GGTGC G 7: 122,838,595 (GRCm39) probably null Het
Tbc1d32 A G 10: 56,050,011 (GRCm39) V509A probably benign Het
Tln1 T A 4: 43,542,525 (GRCm39) T1428S probably benign Het
Ttc27 A T 17: 75,147,454 (GRCm39) I669F probably benign Het
Tubb3 T G 8: 124,147,975 (GRCm39) C303G probably damaging Het
Tulp2 G T 7: 45,168,187 (GRCm39) V188L probably damaging Het
Zfr T C 15: 12,166,249 (GRCm39) Y840H probably damaging Het
Other mutations in Dsp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Dsp APN 13 38,381,822 (GRCm39) missense probably damaging 0.99
IGL01337:Dsp APN 13 38,376,663 (GRCm39) missense probably benign 0.44
IGL01371:Dsp APN 13 38,377,593 (GRCm39) missense probably benign 0.13
IGL01473:Dsp APN 13 38,351,547 (GRCm39) missense probably damaging 0.99
IGL01660:Dsp APN 13 38,360,471 (GRCm39) missense possibly damaging 0.90
IGL01723:Dsp APN 13 38,363,060 (GRCm39) missense probably damaging 1.00
IGL01999:Dsp APN 13 38,365,162 (GRCm39) missense probably damaging 0.99
IGL02313:Dsp APN 13 38,380,499 (GRCm39) nonsense probably null
IGL02833:Dsp APN 13 38,376,897 (GRCm39) missense possibly damaging 0.56
IGL03050:Dsp APN 13 38,372,421 (GRCm39) splice site probably benign
IGL03353:Dsp APN 13 38,370,671 (GRCm39) missense probably damaging 1.00
R0052:Dsp UTSW 13 38,381,340 (GRCm39) missense possibly damaging 0.93
R0052:Dsp UTSW 13 38,381,340 (GRCm39) missense possibly damaging 0.93
R0078:Dsp UTSW 13 38,379,993 (GRCm39) missense probably benign 0.22
R0230:Dsp UTSW 13 38,381,681 (GRCm39) missense probably benign 0.03
R0234:Dsp UTSW 13 38,371,869 (GRCm39) missense probably benign 0.13
R0234:Dsp UTSW 13 38,371,869 (GRCm39) missense probably benign 0.13
R0285:Dsp UTSW 13 38,356,770 (GRCm39) missense probably benign
R0326:Dsp UTSW 13 38,376,846 (GRCm39) nonsense probably null
R0332:Dsp UTSW 13 38,366,204 (GRCm39) nonsense probably null
R0471:Dsp UTSW 13 38,377,326 (GRCm39) nonsense probably null
R0567:Dsp UTSW 13 38,376,414 (GRCm39) missense probably benign 0.01
R0611:Dsp UTSW 13 38,371,717 (GRCm39) missense probably damaging 1.00
R0718:Dsp UTSW 13 38,380,740 (GRCm39) missense possibly damaging 0.80
R0926:Dsp UTSW 13 38,367,194 (GRCm39) missense probably damaging 0.97
R1078:Dsp UTSW 13 38,367,082 (GRCm39) splice site probably benign
R1183:Dsp UTSW 13 38,375,716 (GRCm39) nonsense probably null
R1188:Dsp UTSW 13 38,378,939 (GRCm39) missense probably damaging 1.00
R1419:Dsp UTSW 13 38,370,671 (GRCm39) missense probably damaging 1.00
R1445:Dsp UTSW 13 38,375,907 (GRCm39) missense probably damaging 0.98
R1467:Dsp UTSW 13 38,376,688 (GRCm39) missense probably benign 0.00
R1467:Dsp UTSW 13 38,376,688 (GRCm39) missense probably benign 0.00
R1478:Dsp UTSW 13 38,365,114 (GRCm39) missense probably damaging 1.00
R1568:Dsp UTSW 13 38,359,123 (GRCm39) missense probably damaging 1.00
R1572:Dsp UTSW 13 38,379,714 (GRCm39) missense probably damaging 1.00
R1676:Dsp UTSW 13 38,377,350 (GRCm39) nonsense probably null
R1736:Dsp UTSW 13 38,376,966 (GRCm39) missense probably benign 0.01
R1776:Dsp UTSW 13 38,380,593 (GRCm39) missense probably damaging 0.99
R1829:Dsp UTSW 13 38,377,171 (GRCm39) missense probably damaging 1.00
R1878:Dsp UTSW 13 38,348,831 (GRCm39) missense possibly damaging 0.53
R2013:Dsp UTSW 13 38,375,434 (GRCm39) missense probably damaging 1.00
R2161:Dsp UTSW 13 38,380,427 (GRCm39) missense probably damaging 1.00
R2187:Dsp UTSW 13 38,360,383 (GRCm39) missense probably damaging 1.00
R2295:Dsp UTSW 13 38,381,022 (GRCm39) missense probably benign 0.28
R2495:Dsp UTSW 13 38,377,453 (GRCm39) missense possibly damaging 0.91
R2566:Dsp UTSW 13 38,380,380 (GRCm39) missense probably damaging 1.00
R2888:Dsp UTSW 13 38,376,224 (GRCm39) missense possibly damaging 0.92
R3614:Dsp UTSW 13 38,361,175 (GRCm39) missense probably damaging 0.98
R3725:Dsp UTSW 13 38,381,594 (GRCm39) missense probably benign 0.00
R3725:Dsp UTSW 13 38,378,665 (GRCm39) splice site probably null
R3797:Dsp UTSW 13 38,361,260 (GRCm39) critical splice donor site probably null
R3841:Dsp UTSW 13 38,381,681 (GRCm39) missense probably benign
R4030:Dsp UTSW 13 38,375,404 (GRCm39) missense possibly damaging 0.84
R4124:Dsp UTSW 13 38,370,689 (GRCm39) missense probably damaging 1.00
R4279:Dsp UTSW 13 38,369,207 (GRCm39) missense probably damaging 1.00
R4334:Dsp UTSW 13 38,380,640 (GRCm39) missense possibly damaging 0.46
R4419:Dsp UTSW 13 38,379,108 (GRCm39) missense probably damaging 1.00
R4615:Dsp UTSW 13 38,375,608 (GRCm39) missense probably damaging 0.98
R4627:Dsp UTSW 13 38,352,617 (GRCm39) missense probably benign 0.01
R4639:Dsp UTSW 13 38,380,760 (GRCm39) missense probably damaging 1.00
R4687:Dsp UTSW 13 38,375,595 (GRCm39) missense probably damaging 1.00
R4735:Dsp UTSW 13 38,380,016 (GRCm39) missense probably damaging 0.99
R4746:Dsp UTSW 13 38,379,080 (GRCm39) missense possibly damaging 0.51
R4772:Dsp UTSW 13 38,351,504 (GRCm39) nonsense probably null
R4830:Dsp UTSW 13 38,376,840 (GRCm39) missense probably benign
R4850:Dsp UTSW 13 38,376,445 (GRCm39) missense probably damaging 1.00
R4959:Dsp UTSW 13 38,375,686 (GRCm39) missense probably benign 0.41
R4963:Dsp UTSW 13 38,381,846 (GRCm39) missense probably damaging 0.99
R4969:Dsp UTSW 13 38,376,886 (GRCm39) missense probably benign 0.00
R4978:Dsp UTSW 13 38,366,210 (GRCm39) missense probably damaging 1.00
R4989:Dsp UTSW 13 38,381,678 (GRCm39) missense possibly damaging 0.93
R5068:Dsp UTSW 13 38,381,099 (GRCm39) missense possibly damaging 0.78
R5069:Dsp UTSW 13 38,381,099 (GRCm39) missense possibly damaging 0.78
R5070:Dsp UTSW 13 38,381,099 (GRCm39) missense possibly damaging 0.78
R5133:Dsp UTSW 13 38,381,678 (GRCm39) missense possibly damaging 0.93
R5138:Dsp UTSW 13 38,379,821 (GRCm39) missense possibly damaging 0.50
R5138:Dsp UTSW 13 38,367,274 (GRCm39) missense probably benign 0.37
R5153:Dsp UTSW 13 38,366,282 (GRCm39) missense probably damaging 1.00
R5199:Dsp UTSW 13 38,376,878 (GRCm39) nonsense probably null
R5226:Dsp UTSW 13 38,370,746 (GRCm39) missense probably damaging 0.99
R5265:Dsp UTSW 13 38,379,159 (GRCm39) missense possibly damaging 0.95
R5371:Dsp UTSW 13 38,378,865 (GRCm39) missense probably damaging 0.97
R5484:Dsp UTSW 13 38,368,014 (GRCm39) missense possibly damaging 0.48
R5534:Dsp UTSW 13 38,379,818 (GRCm39) missense probably benign 0.01
R5569:Dsp UTSW 13 38,376,628 (GRCm39) missense probably benign 0.01
R5854:Dsp UTSW 13 38,351,477 (GRCm39) splice site probably null
R5910:Dsp UTSW 13 38,376,445 (GRCm39) missense possibly damaging 0.95
R5929:Dsp UTSW 13 38,379,410 (GRCm39) missense possibly damaging 0.92
R5940:Dsp UTSW 13 38,380,002 (GRCm39) missense possibly damaging 0.70
R5948:Dsp UTSW 13 38,379,377 (GRCm39) missense possibly damaging 0.95
R5955:Dsp UTSW 13 38,378,934 (GRCm39) missense possibly damaging 0.73
R5970:Dsp UTSW 13 38,379,678 (GRCm39) missense possibly damaging 0.93
R6054:Dsp UTSW 13 38,351,585 (GRCm39) missense probably benign 0.00
R6113:Dsp UTSW 13 38,376,023 (GRCm39) missense probably damaging 1.00
R6139:Dsp UTSW 13 38,376,382 (GRCm39) missense probably damaging 0.97
R6328:Dsp UTSW 13 38,380,982 (GRCm39) nonsense probably null
R6527:Dsp UTSW 13 38,379,849 (GRCm39) missense probably damaging 1.00
R6573:Dsp UTSW 13 38,380,838 (GRCm39) missense probably damaging 1.00
R6628:Dsp UTSW 13 38,351,598 (GRCm39) missense possibly damaging 0.73
R6738:Dsp UTSW 13 38,376,186 (GRCm39) missense possibly damaging 0.87
R6898:Dsp UTSW 13 38,376,193 (GRCm39) missense possibly damaging 0.59
R6919:Dsp UTSW 13 38,351,631 (GRCm39) missense possibly damaging 0.84
R6951:Dsp UTSW 13 38,351,622 (GRCm39) missense possibly damaging 0.95
R7017:Dsp UTSW 13 38,370,683 (GRCm39) missense probably benign 0.02
R7022:Dsp UTSW 13 38,375,716 (GRCm39) missense probably benign 0.06
R7135:Dsp UTSW 13 38,363,049 (GRCm39) missense probably damaging 1.00
R7192:Dsp UTSW 13 38,379,569 (GRCm39) missense probably benign 0.09
R7211:Dsp UTSW 13 38,372,511 (GRCm39) critical splice donor site probably null
R7251:Dsp UTSW 13 38,377,524 (GRCm39) missense probably benign 0.02
R7326:Dsp UTSW 13 38,376,859 (GRCm39) missense probably benign 0.01
R7369:Dsp UTSW 13 38,381,501 (GRCm39) missense possibly damaging 0.82
R7376:Dsp UTSW 13 38,356,819 (GRCm39) missense probably damaging 1.00
R7406:Dsp UTSW 13 38,381,172 (GRCm39) missense possibly damaging 0.63
R7439:Dsp UTSW 13 38,379,425 (GRCm39) missense probably benign 0.00
R7439:Dsp UTSW 13 38,360,478 (GRCm39) critical splice donor site probably null
R7441:Dsp UTSW 13 38,379,425 (GRCm39) missense probably benign 0.00
R7477:Dsp UTSW 13 38,356,839 (GRCm39) missense probably damaging 1.00
R7535:Dsp UTSW 13 38,376,765 (GRCm39) missense probably benign 0.05
R7558:Dsp UTSW 13 38,352,742 (GRCm39) missense probably benign 0.02
R7600:Dsp UTSW 13 38,375,691 (GRCm39) missense probably damaging 1.00
R7616:Dsp UTSW 13 38,375,458 (GRCm39) missense probably damaging 0.98
R7702:Dsp UTSW 13 38,359,183 (GRCm39) missense possibly damaging 0.83
R7738:Dsp UTSW 13 38,369,151 (GRCm39) missense probably damaging 0.97
R7815:Dsp UTSW 13 38,375,446 (GRCm39) missense probably benign 0.31
R7882:Dsp UTSW 13 38,367,994 (GRCm39) missense possibly damaging 0.76
R7917:Dsp UTSW 13 38,351,615 (GRCm39) nonsense probably null
R7971:Dsp UTSW 13 38,376,499 (GRCm39) missense probably damaging 0.97
R8104:Dsp UTSW 13 38,352,600 (GRCm39) missense probably benign 0.03
R8176:Dsp UTSW 13 38,376,786 (GRCm39) missense possibly damaging 0.56
R8303:Dsp UTSW 13 38,381,319 (GRCm39) missense probably benign
R8323:Dsp UTSW 13 38,356,806 (GRCm39) missense possibly damaging 0.80
R8326:Dsp UTSW 13 38,375,611 (GRCm39) missense probably damaging 1.00
R8358:Dsp UTSW 13 38,376,457 (GRCm39) missense possibly damaging 0.92
R8410:Dsp UTSW 13 38,380,791 (GRCm39) missense possibly damaging 0.94
R8552:Dsp UTSW 13 38,369,117 (GRCm39) missense probably damaging 0.98
R8713:Dsp UTSW 13 38,352,701 (GRCm39) missense probably damaging 0.99
R8801:Dsp UTSW 13 38,381,502 (GRCm39) missense possibly damaging 0.81
R8900:Dsp UTSW 13 38,365,155 (GRCm39) missense probably damaging 0.99
R8901:Dsp UTSW 13 38,365,155 (GRCm39) missense probably damaging 0.99
R8968:Dsp UTSW 13 38,335,596 (GRCm39) missense possibly damaging 0.83
R9014:Dsp UTSW 13 38,376,700 (GRCm39) missense possibly damaging 0.83
R9021:Dsp UTSW 13 38,380,808 (GRCm39) missense possibly damaging 0.61
R9030:Dsp UTSW 13 38,352,673 (GRCm39) missense probably damaging 1.00
R9124:Dsp UTSW 13 38,377,276 (GRCm39) missense probably benign 0.42
R9129:Dsp UTSW 13 38,377,126 (GRCm39) missense probably benign 0.09
R9143:Dsp UTSW 13 38,377,337 (GRCm39) missense probably benign 0.05
R9450:Dsp UTSW 13 38,376,379 (GRCm39) missense probably damaging 1.00
R9488:Dsp UTSW 13 38,377,218 (GRCm39) missense probably benign 0.04
R9514:Dsp UTSW 13 38,371,781 (GRCm39) missense probably benign 0.02
R9789:Dsp UTSW 13 38,367,937 (GRCm39) missense probably benign 0.03
R9792:Dsp UTSW 13 38,379,494 (GRCm39) missense possibly damaging 0.87
X0023:Dsp UTSW 13 38,381,660 (GRCm39) missense probably benign 0.00
X0024:Dsp UTSW 13 38,377,231 (GRCm39) missense probably benign 0.04
X0027:Dsp UTSW 13 38,370,622 (GRCm39) missense possibly damaging 0.68
X0067:Dsp UTSW 13 38,366,288 (GRCm39) missense possibly damaging 0.85
Z1176:Dsp UTSW 13 38,381,166 (GRCm39) missense possibly damaging 0.81
Z1177:Dsp UTSW 13 38,376,830 (GRCm39) frame shift probably null
Z1177:Dsp UTSW 13 38,335,665 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAGGCGTCCATTGTTAAGAAG -3'
(R):5'- CCTTAGCTCGGAGATGGTTGAG -3'

Sequencing Primer
(F):5'- CGTCCATTGTTAAGAAGAGGAGC -3'
(R):5'- GAGTTTTTATCGCTGTCCGC -3'
Posted On 2015-01-11