Mutagenetix > Incidental Mutation

Incidental Mutation 'R3012:Zfr'

257547

Institutional Source

Beutler Lab

Gene Symbol

Zfr

Ensembl Gene

ENSMUSG00000022201

Gene Name

zinc finger RNA binding protein

Synonyms

C920030H05Rik

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3012 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12117917-12185769 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 12166249 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 840 (Y840H)

Ref Sequence

ENSEMBL: ENSMUSP00000118911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000122941]

AlphaFold

O88532

Predicted Effect

probably damaging
Transcript: ENSMUST00000122941
AA Change: Y840H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118911
Gene: ENSMUSG00000022201
AA Change: Y840H

Domain	Start	End	E-Value	Type
low complexity region	69	116	N/A	INTRINSIC
low complexity region	159	182	N/A	INTRINSIC
low complexity region	196	224	N/A	INTRINSIC
low complexity region	229	302	N/A	INTRINSIC
ZnF_U1	328	362	7.79e-6	SMART
ZnF_C2H2	331	355	4.94e0	SMART
ZnF_U1	379	413	1.84e-7	SMART
ZnF_C2H2	382	406	4.65e-1	SMART
low complexity region	429	448	N/A	INTRINSIC
low complexity region	468	483	N/A	INTRINSIC
ZnF_U1	579	613	2.01e-8	SMART
ZnF_C2H2	582	606	1.31e0	SMART
low complexity region	630	664	N/A	INTRINSIC
low complexity region	685	719	N/A	INTRINSIC
low complexity region	766	782	N/A	INTRINSIC
DZF	784	1038	5.42e-170	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147492

Predicted Effect

probably benign
Transcript: ENSMUST00000155054

SMART Domains

Protein: ENSMUSP00000114992
Gene: ENSMUSG00000022201

Domain	Start	End	E-Value	Type
low complexity region	19	53	N/A	INTRINSIC
PDB:4ATB\|D	56	94	6e-11	PDB
low complexity region	100	114	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000156752
AA Change: Y112H

SMART Domains

Protein: ENSMUSP00000119251
Gene: ENSMUSG00000022201
AA Change: Y112H

Domain	Start	End	E-Value	Type
low complexity region	34	52	N/A	INTRINSIC
DZF	57	299	1.79e-152	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000157034
AA Change: Y2H

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein characterized by its DZF (domain associated with zinc fingers) domain. The encoded protein may play a role in the nucleocytoplasmic shuttling of another RNA-binding protein, Staufen homolog 2, in neurons. Expression of this gene is regulated through alternative polyadenylation that mediates differential microRNA targeting. Elevated expression of this gene has been observed in human patients with pancreatic cancer and knockdown of this gene may result in reduced viability and invasion of pancreatic cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired gastrulation, with increased apoptosis and a low mitotic index, and die between embryonic days 8 and 9. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh18a1	G	T	19: 40,546,135 (GRCm39)	Y585*	probably null	Het
Ankrd17	G	A	5: 90,378,727 (GRCm39)	P2563S	probably damaging	Het
Atg10	A	T	13: 91,302,397 (GRCm39)	F47Y	probably damaging	Het
Ccdc39	C	T	3: 33,868,817 (GRCm39)	R798Q	probably damaging	Het
Cfi	A	G	3: 129,668,579 (GRCm39)	D535G	probably damaging	Het
Dennd11	T	C	6: 40,412,926 (GRCm39)	E45G	probably benign	Het
Dgat1	T	A	15: 76,387,593 (GRCm39)	Q308H	possibly damaging	Het
Dsp	T	C	13: 38,377,318 (GRCm39)	I1701T	possibly damaging	Het
Egr2	GAA	GA	10: 67,375,733 (GRCm39)		probably null	Het
Fes	G	C	7: 80,036,915 (GRCm39)	S56R	possibly damaging	Het
Gria1	G	A	11: 57,180,260 (GRCm39)	V737M	probably damaging	Het
Gtf2h1	A	G	7: 46,453,319 (GRCm39)	H84R	probably damaging	Het
Ifi208	A	G	1: 173,523,136 (GRCm39)		probably null	Het
Il15	T	A	8: 83,071,049 (GRCm39)	N22I	probably damaging	Het
Me1	A	G	9: 86,493,965 (GRCm39)	S323P	probably benign	Het
Or10a5	T	C	7: 106,635,569 (GRCm39)	F69S	possibly damaging	Het
Parp4	T	C	14: 56,832,873 (GRCm39)		probably null	Het
Pcdhga7	A	G	18: 37,848,691 (GRCm39)	T233A	probably benign	Het
Rab36	G	A	10: 74,880,328 (GRCm39)	V63I	probably damaging	Het
Rpe65	G	T	3: 159,310,200 (GRCm39)	V128F	possibly damaging	Het
Slc5a11	GGTGC	G	7: 122,838,595 (GRCm39)		probably null	Het
Tbc1d32	A	G	10: 56,050,011 (GRCm39)	V509A	probably benign	Het
Tln1	T	A	4: 43,542,525 (GRCm39)	T1428S	probably benign	Het
Ttc27	A	T	17: 75,147,454 (GRCm39)	I669F	probably benign	Het
Tubb3	T	G	8: 124,147,975 (GRCm39)	C303G	probably damaging	Het
Tulp2	G	T	7: 45,168,187 (GRCm39)	V188L	probably damaging	Het

Other mutations in Zfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01637:Zfr	APN	15	12,159,732 (GRCm39)	missense	probably benign	0.26
IGL01759:Zfr	APN	15	12,159,741 (GRCm39)	missense	probably damaging	0.99
IGL01935:Zfr	APN	15	12,180,798 (GRCm39)	missense	probably benign	0.42
IGL02056:Zfr	APN	15	12,154,533 (GRCm39)	missense	probably damaging	1.00
IGL03009:Zfr	APN	15	12,162,321 (GRCm39)	missense	probably damaging	1.00
IGL03147:Zfr	UTSW	15	12,140,638 (GRCm39)	nonsense	probably null
PIT4504001:Zfr	UTSW	15	12,166,244 (GRCm39)	missense	possibly damaging	0.48
R0377:Zfr	UTSW	15	12,160,677 (GRCm39)	missense	probably benign	0.02
R0678:Zfr	UTSW	15	12,184,171 (GRCm39)	missense	probably damaging	1.00
R0783:Zfr	UTSW	15	12,162,268 (GRCm39)	missense	probably damaging	1.00
R0787:Zfr	UTSW	15	12,140,634 (GRCm39)	missense	unknown
R1464:Zfr	UTSW	15	12,146,458 (GRCm39)	missense	probably damaging	1.00
R1464:Zfr	UTSW	15	12,146,458 (GRCm39)	missense	probably damaging	1.00
R1538:Zfr	UTSW	15	12,150,329 (GRCm39)	missense	possibly damaging	0.61
R1558:Zfr	UTSW	15	12,140,730 (GRCm39)	missense	unknown
R1619:Zfr	UTSW	15	12,150,473 (GRCm39)	missense	possibly damaging	0.52
R1924:Zfr	UTSW	15	12,160,715 (GRCm39)	missense	possibly damaging	0.74
R2163:Zfr	UTSW	15	12,162,309 (GRCm39)	missense	probably damaging	1.00
R2958:Zfr	UTSW	15	12,162,319 (GRCm39)	missense	probably benign	0.08
R2960:Zfr	UTSW	15	12,162,319 (GRCm39)	missense	probably benign	0.08
R2961:Zfr	UTSW	15	12,162,319 (GRCm39)	missense	probably benign	0.08
R2962:Zfr	UTSW	15	12,162,319 (GRCm39)	missense	probably benign	0.08
R2963:Zfr	UTSW	15	12,162,319 (GRCm39)	missense	probably benign	0.08
R3054:Zfr	UTSW	15	12,154,593 (GRCm39)	missense	probably damaging	1.00
R3429:Zfr	UTSW	15	12,153,006 (GRCm39)	missense	probably benign	0.00
R3611:Zfr	UTSW	15	12,159,848 (GRCm39)	critical splice donor site	probably null
R3825:Zfr	UTSW	15	12,166,277 (GRCm39)	missense	probably damaging	1.00
R3882:Zfr	UTSW	15	12,162,319 (GRCm39)	missense	probably benign	0.08
R4080:Zfr	UTSW	15	12,162,319 (GRCm39)	missense	probably benign	0.08
R4241:Zfr	UTSW	15	12,149,745 (GRCm39)	missense	probably damaging	1.00
R4366:Zfr	UTSW	15	12,156,416 (GRCm39)	missense	probably damaging	0.99
R4375:Zfr	UTSW	15	12,118,426 (GRCm39)	critical splice donor site	probably null
R4893:Zfr	UTSW	15	12,136,628 (GRCm39)	missense	unknown
R4899:Zfr	UTSW	15	12,166,231 (GRCm39)	missense	probably benign	0.11
R4915:Zfr	UTSW	15	12,162,198 (GRCm39)	critical splice acceptor site	probably null
R5870:Zfr	UTSW	15	12,160,701 (GRCm39)	missense	probably damaging	1.00
R6162:Zfr	UTSW	15	12,146,331 (GRCm39)	missense	unknown
R6163:Zfr	UTSW	15	12,146,331 (GRCm39)	missense	unknown
R6165:Zfr	UTSW	15	12,146,331 (GRCm39)	missense	unknown
R6187:Zfr	UTSW	15	12,146,317 (GRCm39)	small deletion	probably benign
R6251:Zfr	UTSW	15	12,160,677 (GRCm39)	missense	probably benign	0.02
R6903:Zfr	UTSW	15	12,136,541 (GRCm39)	missense	unknown
R6959:Zfr	UTSW	15	12,150,409 (GRCm39)	missense	probably damaging	1.00
R7133:Zfr	UTSW	15	12,180,724 (GRCm39)	missense	probably damaging	1.00
R7167:Zfr	UTSW	15	12,181,015 (GRCm39)	missense	probably benign	0.01
R7212:Zfr	UTSW	15	12,146,309 (GRCm39)	nonsense	probably null
R7373:Zfr	UTSW	15	12,140,645 (GRCm39)	missense	unknown
R7489:Zfr	UTSW	15	12,153,068 (GRCm39)	missense	probably benign	0.24
R7602:Zfr	UTSW	15	12,159,763 (GRCm39)	missense	possibly damaging	0.56
R7623:Zfr	UTSW	15	12,160,614 (GRCm39)	missense	possibly damaging	0.83
R7896:Zfr	UTSW	15	12,146,463 (GRCm39)	missense	probably damaging	1.00
R8188:Zfr	UTSW	15	12,171,904 (GRCm39)	missense	probably damaging	1.00
R8289:Zfr	UTSW	15	12,135,357 (GRCm39)	missense	noncoding transcript
R8382:Zfr	UTSW	15	12,153,054 (GRCm39)	nonsense	probably null
R8475:Zfr	UTSW	15	12,150,455 (GRCm39)	missense	probably benign	0.08
R9124:Zfr	UTSW	15	12,136,757 (GRCm39)	missense	unknown
R9493:Zfr	UTSW	15	12,180,706 (GRCm39)	critical splice acceptor site	probably null
R9598:Zfr	UTSW	15	12,162,292 (GRCm39)	missense	probably damaging	0.99
R9631:Zfr	UTSW	15	12,154,628 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GTAATCTGGGTACTCTGGCATG -3'
(R):5'- AGCATGTTGCCTTCTAGGG -3'

Sequencing Primer
(F):5'- ACTCTGGCATGTGTTTTTAGAGG -3'
(R):5'- CTGAATGCCATCATAAAGGGTAG -3'

Posted On

2015-01-11