Mutagenetix > Incidental Mutation

Incidental Mutation 'R3013:Dnah7b'

257552

Institutional Source

Beutler Lab

Gene Symbol

Dnah7b

Ensembl Gene

ENSMUSG00000041144

Gene Name

dynein, axonemal, heavy chain 7B

Synonyms

Dnahc7b, LOC227058

MMRRC Submission

040534-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.118) question?

Stock #

R3013 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46066315-46373546 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 46188687 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000068738 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069293]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000069293

SMART Domains

Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144

Domain	Start	End	E-Value	Type
coiled coil region	760	790	N/A	INTRINSIC
Pfam:DHC_N2	800	1209	3.7e-150	PFAM
AAA	1364	1503	3.24e-1	SMART
AAA	2012	2160	5.39e-2	SMART
Pfam:AAA_8	2347	2618	2.4e-75	PFAM
Pfam:MT	2630	2979	2.6e-54	PFAM
Pfam:AAA_9	3001	3226	2.3e-98	PFAM
Pfam:Dynein_heavy	3362	4064	8.4e-288	PFAM

Meta Mutation Damage Score

0.9485

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

97% (32/33)

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afg3l1	C	T	8: 123,484,677 (GRCm38)	R126W	probably benign	Het
Alg10b	T	A	15: 90,227,556 (GRCm38)	I201N	possibly damaging	Het
Arid2	T	C	15: 96,361,936 (GRCm38)	S326P	probably damaging	Het
Ash2l	T	C	8: 25,839,764 (GRCm38)	D122G	probably damaging	Het
Bpifb5	T	C	2: 154,228,855 (GRCm38)	S189P	possibly damaging	Het
Ccdc39	C	T	3: 33,814,668 (GRCm38)	R798Q	probably damaging	Het
Ccdc57	A	G	11: 120,861,199 (GRCm38)	V852A	probably benign	Het
Ces1e	G	A	8: 93,203,287 (GRCm38)	S455L	probably benign	Het
Cyp4f14	T	C	17: 32,909,165 (GRCm38)	K292R	probably benign	Het
Eml5	T	C	12: 98,880,808 (GRCm38)		probably null	Het
Gm13119	T	A	4: 144,362,455 (GRCm38)	D114E	probably damaging	Het
Gtf2i	T	C	5: 134,295,504 (GRCm38)		probably benign	Het
Hip1	T	A	5: 135,435,039 (GRCm38)	E37V	possibly damaging	Het
Hspbp1	G	T	7: 4,663,484 (GRCm38)	T299K	probably benign	Het
Lrpprc	T	C	17: 84,767,069 (GRCm38)	D470G	probably benign	Het
Mkx	A	T	18: 6,936,929 (GRCm38)	I334N	probably damaging	Het
Obscn	A	T	11: 59,060,918 (GRCm38)	L4003Q	probably damaging	Het
Pcnx2	C	A	8: 125,887,770 (GRCm38)	C314F	probably benign	Het
Prr5l	A	G	2: 101,734,705 (GRCm38)	F162S	probably damaging	Het
Rbfox2	T	C	15: 77,132,920 (GRCm38)	T17A	probably damaging	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904 (GRCm38)		probably benign	Het
Ryr3	A	T	2: 112,640,281 (GRCm38)	F4610L	probably damaging	Het
Scp2	T	A	4: 108,071,357 (GRCm38)	R379W	probably damaging	Het
Serpina3j	A	G	12: 104,319,707 (GRCm38)	T374A	probably damaging	Het
Smad4	T	C	18: 73,648,904 (GRCm38)	Y429C	probably damaging	Het
Ttn	T	C	2: 76,734,681 (GRCm38)	T28401A	probably damaging	Het
Wdr49	A	G	3: 75,450,847 (GRCm38)	I260T	probably damaging	Het
Xirp1	T	C	9: 120,019,785 (GRCm38)	T11A	probably benign	Het
Zfp235	A	G	7: 24,140,732 (GRCm38)	D262G	probably damaging	Het

Other mutations in Dnah7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Dnah7b	APN	1	46,142,149 (GRCm38)	missense	probably benign	0.04
IGL00796:Dnah7b	APN	1	46,211,337 (GRCm38)	missense	probably damaging	0.96
IGL00825:Dnah7b	APN	1	46,224,651 (GRCm38)	missense	probably damaging	1.00
IGL00910:Dnah7b	APN	1	46,066,729 (GRCm38)	unclassified	probably benign
IGL00950:Dnah7b	APN	1	46,214,322 (GRCm38)	missense	probably benign	0.07
IGL01142:Dnah7b	APN	1	46,195,378 (GRCm38)	critical splice donor site	probably null
IGL01350:Dnah7b	APN	1	46,081,432 (GRCm38)	splice site	probably benign
IGL01392:Dnah7b	APN	1	46,126,788 (GRCm38)	missense	probably damaging	1.00
IGL01403:Dnah7b	APN	1	46,116,300 (GRCm38)	splice site	probably benign
IGL01460:Dnah7b	APN	1	46,139,704 (GRCm38)	missense	possibly damaging	0.82
IGL01576:Dnah7b	APN	1	46,268,653 (GRCm38)	missense	probably damaging	1.00
IGL01693:Dnah7b	APN	1	46,358,147 (GRCm38)	missense	probably benign	0.29
IGL01838:Dnah7b	APN	1	46,358,137 (GRCm38)	nonsense	probably null
IGL01906:Dnah7b	APN	1	46,175,453 (GRCm38)	missense	probably damaging	1.00
IGL01960:Dnah7b	APN	1	46,124,337 (GRCm38)	splice site	probably benign
IGL01989:Dnah7b	APN	1	46,289,534 (GRCm38)	missense	probably damaging	1.00
IGL02127:Dnah7b	APN	1	46,139,875 (GRCm38)	missense	probably benign
IGL02213:Dnah7b	APN	1	46,233,592 (GRCm38)	missense	probably damaging	0.97
IGL02267:Dnah7b	APN	1	46,226,930 (GRCm38)	missense	probably damaging	1.00
IGL02349:Dnah7b	APN	1	46,099,503 (GRCm38)	nonsense	probably null
IGL02381:Dnah7b	APN	1	46,277,120 (GRCm38)	missense	probably damaging	1.00
IGL02473:Dnah7b	APN	1	46,234,193 (GRCm38)	missense	probably damaging	1.00
IGL02484:Dnah7b	APN	1	46,195,318 (GRCm38)	missense	probably damaging	1.00
IGL02590:Dnah7b	APN	1	46,123,777 (GRCm38)	missense	probably benign	0.02
IGL02655:Dnah7b	APN	1	46,116,301 (GRCm38)	splice site	probably benign
IGL02704:Dnah7b	APN	1	46,142,133 (GRCm38)	missense	probably benign	0.03
IGL02719:Dnah7b	APN	1	46,099,608 (GRCm38)	splice site	probably benign
IGL02745:Dnah7b	APN	1	46,195,029 (GRCm38)	splice site	probably benign
IGL02818:Dnah7b	APN	1	46,290,808 (GRCm38)	missense	probably damaging	1.00
IGL02892:Dnah7b	APN	1	46,119,298 (GRCm38)	missense	possibly damaging	0.79
IGL03285:Dnah7b	APN	1	46,182,375 (GRCm38)	missense	probably benign	0.00
IGL03354:Dnah7b	APN	1	46,085,689 (GRCm38)	missense	probably damaging	1.00
IGL03355:Dnah7b	APN	1	46,119,304 (GRCm38)	missense	probably benign	0.18
BB001:Dnah7b	UTSW	1	46,219,430 (GRCm38)	missense	probably benign	0.04
BB011:Dnah7b	UTSW	1	46,219,430 (GRCm38)	missense	probably benign	0.04
PIT4305001:Dnah7b	UTSW	1	46,373,348 (GRCm38)	missense	probably damaging	1.00
R0116:Dnah7b	UTSW	1	46,213,360 (GRCm38)	missense	possibly damaging	0.94
R0145:Dnah7b	UTSW	1	46,223,178 (GRCm38)	missense	probably damaging	1.00
R0230:Dnah7b	UTSW	1	46,219,348 (GRCm38)	missense	probably damaging	1.00
R0302:Dnah7b	UTSW	1	46,123,777 (GRCm38)	missense	probably benign	0.26
R0313:Dnah7b	UTSW	1	46,207,643 (GRCm38)	missense	probably damaging	1.00
R0317:Dnah7b	UTSW	1	46,134,656 (GRCm38)	missense	probably damaging	1.00
R0347:Dnah7b	UTSW	1	46,240,944 (GRCm38)	missense	probably damaging	1.00
R0352:Dnah7b	UTSW	1	46,277,126 (GRCm38)	missense	probably damaging	0.98
R0363:Dnah7b	UTSW	1	46,236,788 (GRCm38)	missense	probably damaging	0.99
R0379:Dnah7b	UTSW	1	46,140,176 (GRCm38)	missense	probably benign	0.00
R0502:Dnah7b	UTSW	1	46,219,544 (GRCm38)	missense	probably damaging	0.96
R0602:Dnah7b	UTSW	1	46,324,842 (GRCm38)	missense	probably damaging	1.00
R0631:Dnah7b	UTSW	1	46,240,992 (GRCm38)	missense	probably benign	0.02
R0664:Dnah7b	UTSW	1	46,324,842 (GRCm38)	missense	probably damaging	1.00
R0882:Dnah7b	UTSW	1	46,340,132 (GRCm38)	missense	probably benign	0.00
R0931:Dnah7b	UTSW	1	46,099,612 (GRCm38)	splice site	probably benign
R1035:Dnah7b	UTSW	1	46,124,448 (GRCm38)	missense	probably benign
R1147:Dnah7b	UTSW	1	46,340,266 (GRCm38)	missense	probably damaging	0.99
R1147:Dnah7b	UTSW	1	46,340,266 (GRCm38)	missense	probably damaging	0.99
R1166:Dnah7b	UTSW	1	46,325,810 (GRCm38)	missense	probably damaging	1.00
R1219:Dnah7b	UTSW	1	46,340,120 (GRCm38)	missense	probably benign	0.00
R1318:Dnah7b	UTSW	1	46,099,509 (GRCm38)	missense	possibly damaging	0.80
R1334:Dnah7b	UTSW	1	46,322,335 (GRCm38)	missense	probably damaging	0.99
R1429:Dnah7b	UTSW	1	46,289,656 (GRCm38)	missense	possibly damaging	0.84
R1440:Dnah7b	UTSW	1	46,078,593 (GRCm38)	splice site	probably benign
R1484:Dnah7b	UTSW	1	46,137,543 (GRCm38)	missense	probably benign	0.00
R1529:Dnah7b	UTSW	1	46,177,281 (GRCm38)	missense	probably damaging	1.00
R1544:Dnah7b	UTSW	1	46,066,797 (GRCm38)	missense	unknown
R1607:Dnah7b	UTSW	1	46,290,646 (GRCm38)	missense	probably damaging	1.00
R1609:Dnah7b	UTSW	1	46,352,966 (GRCm38)	missense	probably damaging	1.00
R1652:Dnah7b	UTSW	1	46,175,390 (GRCm38)	nonsense	probably null
R1681:Dnah7b	UTSW	1	46,324,712 (GRCm38)	nonsense	probably null
R1716:Dnah7b	UTSW	1	46,191,783 (GRCm38)	missense	probably damaging	1.00
R1753:Dnah7b	UTSW	1	46,322,335 (GRCm38)	missense	probably damaging	0.99
R1834:Dnah7b	UTSW	1	46,233,759 (GRCm38)	missense	possibly damaging	0.90
R1838:Dnah7b	UTSW	1	46,277,105 (GRCm38)	missense	probably damaging	1.00
R1838:Dnah7b	UTSW	1	46,116,177 (GRCm38)	missense	probably benign	0.04
R1898:Dnah7b	UTSW	1	46,236,714 (GRCm38)	missense	probably benign	0.02
R1962:Dnah7b	UTSW	1	46,242,103 (GRCm38)	missense	possibly damaging	0.95
R2001:Dnah7b	UTSW	1	46,142,087 (GRCm38)	missense	possibly damaging	0.69
R2049:Dnah7b	UTSW	1	46,268,670 (GRCm38)	missense	probably damaging	1.00
R2076:Dnah7b	UTSW	1	46,242,321 (GRCm38)	nonsense	probably null
R2083:Dnah7b	UTSW	1	46,241,067 (GRCm38)	missense	possibly damaging	0.90
R2140:Dnah7b	UTSW	1	46,268,670 (GRCm38)	missense	probably damaging	1.00
R2141:Dnah7b	UTSW	1	46,268,670 (GRCm38)	missense	probably damaging	1.00
R2142:Dnah7b	UTSW	1	46,268,670 (GRCm38)	missense	probably damaging	1.00
R2165:Dnah7b	UTSW	1	46,097,992 (GRCm38)	splice site	probably benign
R2172:Dnah7b	UTSW	1	46,124,512 (GRCm38)	missense	probably benign	0.12
R2239:Dnah7b	UTSW	1	46,201,184 (GRCm38)	splice site	probably benign
R2247:Dnah7b	UTSW	1	46,277,063 (GRCm38)	missense	probably damaging	1.00
R2267:Dnah7b	UTSW	1	46,233,915 (GRCm38)	missense	probably damaging	1.00
R2405:Dnah7b	UTSW	1	46,362,954 (GRCm38)	missense	probably benign	0.31
R2509:Dnah7b	UTSW	1	46,195,287 (GRCm38)	missense	probably damaging	0.96
R2895:Dnah7b	UTSW	1	46,139,741 (GRCm38)	missense	probably damaging	1.00
R2965:Dnah7b	UTSW	1	46,207,572 (GRCm38)	missense	probably damaging	1.00
R3022:Dnah7b	UTSW	1	46,182,423 (GRCm38)	missense	probably damaging	0.99
R3056:Dnah7b	UTSW	1	46,268,709 (GRCm38)	missense	possibly damaging	0.95
R3107:Dnah7b	UTSW	1	46,352,873 (GRCm38)	missense	probably benign	0.00
R3735:Dnah7b	UTSW	1	46,299,875 (GRCm38)	missense	probably benign	0.05
R3898:Dnah7b	UTSW	1	46,243,257 (GRCm38)	missense	probably damaging	1.00
R3944:Dnah7b	UTSW	1	46,137,485 (GRCm38)	missense	probably damaging	1.00
R3983:Dnah7b	UTSW	1	46,233,711 (GRCm38)	missense	possibly damaging	0.88
R4041:Dnah7b	UTSW	1	46,081,495 (GRCm38)	missense	probably benign
R4172:Dnah7b	UTSW	1	46,226,946 (GRCm38)	missense	probably damaging	1.00
R4210:Dnah7b	UTSW	1	46,137,418 (GRCm38)	missense	possibly damaging	0.63
R4306:Dnah7b	UTSW	1	46,221,772 (GRCm38)	missense	probably damaging	0.99
R4391:Dnah7b	UTSW	1	46,337,594 (GRCm38)	splice site	probably null
R4414:Dnah7b	UTSW	1	46,126,680 (GRCm38)	missense	probably benign	0.00
R4495:Dnah7b	UTSW	1	46,085,632 (GRCm38)	missense	probably benign	0.00
R4660:Dnah7b	UTSW	1	46,289,536 (GRCm38)	missense	probably damaging	1.00
R4670:Dnah7b	UTSW	1	46,078,524 (GRCm38)	missense	probably damaging	1.00
R4675:Dnah7b	UTSW	1	46,217,157 (GRCm38)	missense	possibly damaging	0.89
R4685:Dnah7b	UTSW	1	46,211,328 (GRCm38)	missense	probably damaging	1.00
R4727:Dnah7b	UTSW	1	46,207,656 (GRCm38)	missense	probably damaging	1.00
R4735:Dnah7b	UTSW	1	46,066,955 (GRCm38)	missense	unknown
R4780:Dnah7b	UTSW	1	46,353,014 (GRCm38)	missense	probably benign
R4828:Dnah7b	UTSW	1	46,128,112 (GRCm38)	missense	possibly damaging	0.59
R4859:Dnah7b	UTSW	1	46,356,602 (GRCm38)	missense	probably damaging	1.00
R4865:Dnah7b	UTSW	1	46,195,074 (GRCm38)	missense	probably damaging	1.00
R4871:Dnah7b	UTSW	1	46,081,444 (GRCm38)	missense	probably benign	0.21
R4881:Dnah7b	UTSW	1	46,201,318 (GRCm38)	missense	probably damaging	1.00
R4902:Dnah7b	UTSW	1	46,290,775 (GRCm38)	missense	probably benign	0.04
R4960:Dnah7b	UTSW	1	46,233,726 (GRCm38)	missense	probably benign
R5000:Dnah7b	UTSW	1	46,099,503 (GRCm38)	nonsense	probably null
R5005:Dnah7b	UTSW	1	46,242,028 (GRCm38)	missense	probably damaging	0.99
R5026:Dnah7b	UTSW	1	46,187,363 (GRCm38)	missense	probably damaging	0.99
R5080:Dnah7b	UTSW	1	46,182,380 (GRCm38)	nonsense	probably null
R5174:Dnah7b	UTSW	1	46,243,349 (GRCm38)	missense	possibly damaging	0.83
R5178:Dnah7b	UTSW	1	46,358,216 (GRCm38)	missense	possibly damaging	0.50
R5244:Dnah7b	UTSW	1	46,233,858 (GRCm38)	missense	probably damaging	1.00
R5250:Dnah7b	UTSW	1	46,373,354 (GRCm38)	missense	probably damaging	1.00
R5350:Dnah7b	UTSW	1	46,233,689 (GRCm38)	missense	probably benign	0.16
R5380:Dnah7b	UTSW	1	46,217,191 (GRCm38)	missense	probably benign	0.18
R5387:Dnah7b	UTSW	1	46,188,659 (GRCm38)	missense	probably damaging	1.00
R5423:Dnah7b	UTSW	1	46,358,271 (GRCm38)	missense	probably benign	0.01
R5426:Dnah7b	UTSW	1	46,242,206 (GRCm38)	missense	possibly damaging	0.82
R5451:Dnah7b	UTSW	1	46,242,019 (GRCm38)	missense	possibly damaging	0.73
R5459:Dnah7b	UTSW	1	46,109,312 (GRCm38)	missense	probably null
R5479:Dnah7b	UTSW	1	46,223,105 (GRCm38)	missense	probably damaging	1.00
R5583:Dnah7b	UTSW	1	46,242,199 (GRCm38)	missense	probably benign	0.06
R5637:Dnah7b	UTSW	1	46,356,514 (GRCm38)	missense	possibly damaging	0.95
R5641:Dnah7b	UTSW	1	46,268,764 (GRCm38)	splice site	probably null
R5659:Dnah7b	UTSW	1	46,352,849 (GRCm38)	missense	probably damaging	1.00
R5739:Dnah7b	UTSW	1	46,233,992 (GRCm38)	missense	probably damaging	1.00
R5759:Dnah7b	UTSW	1	46,277,120 (GRCm38)	missense	probably damaging	1.00
R5821:Dnah7b	UTSW	1	46,142,132 (GRCm38)	missense	possibly damaging	0.91
R5874:Dnah7b	UTSW	1	46,191,725 (GRCm38)	missense	probably damaging	1.00
R5892:Dnah7b	UTSW	1	46,337,593 (GRCm38)	critical splice donor site	probably null
R5918:Dnah7b	UTSW	1	46,221,643 (GRCm38)	missense	probably benign
R5941:Dnah7b	UTSW	1	46,187,290 (GRCm38)	missense	probably damaging	1.00
R5965:Dnah7b	UTSW	1	46,362,987 (GRCm38)	missense	probably damaging	1.00
R5987:Dnah7b	UTSW	1	46,119,398 (GRCm38)	splice site	probably null
R6041:Dnah7b	UTSW	1	46,289,645 (GRCm38)	missense	probably benign	0.04
R6043:Dnah7b	UTSW	1	46,139,789 (GRCm38)	missense	probably benign
R6049:Dnah7b	UTSW	1	46,085,602 (GRCm38)	missense	probably benign
R6131:Dnah7b	UTSW	1	46,253,466 (GRCm38)	missense	probably damaging	1.00
R6168:Dnah7b	UTSW	1	46,290,703 (GRCm38)	missense	probably damaging	1.00
R6195:Dnah7b	UTSW	1	46,204,269 (GRCm38)	missense	probably damaging	1.00
R6219:Dnah7b	UTSW	1	46,233,585 (GRCm38)	missense	probably benign	0.03
R6226:Dnah7b	UTSW	1	46,126,668 (GRCm38)	missense	probably benign	0.01
R6233:Dnah7b	UTSW	1	46,204,269 (GRCm38)	missense	probably damaging	1.00
R6247:Dnah7b	UTSW	1	46,225,888 (GRCm38)	missense	probably benign
R6273:Dnah7b	UTSW	1	46,242,316 (GRCm38)	missense	possibly damaging	0.94
R6279:Dnah7b	UTSW	1	46,325,886 (GRCm38)	missense	probably damaging	1.00
R6300:Dnah7b	UTSW	1	46,325,886 (GRCm38)	missense	probably damaging	1.00
R6330:Dnah7b	UTSW	1	46,340,175 (GRCm38)	missense	probably damaging	1.00
R6476:Dnah7b	UTSW	1	46,242,204 (GRCm38)	nonsense	probably null
R6494:Dnah7b	UTSW	1	46,099,431 (GRCm38)	missense	probably damaging	1.00
R6762:Dnah7b	UTSW	1	46,224,742 (GRCm38)	missense	probably benign	0.12
R6800:Dnah7b	UTSW	1	46,340,217 (GRCm38)	missense	possibly damaging	0.90
R6838:Dnah7b	UTSW	1	46,191,788 (GRCm38)	missense	probably damaging	1.00
R6937:Dnah7b	UTSW	1	46,195,120 (GRCm38)	missense	probably damaging	1.00
R6940:Dnah7b	UTSW	1	46,119,268 (GRCm38)	missense	probably benign	0.12
R6969:Dnah7b	UTSW	1	46,358,238 (GRCm38)	missense	probably damaging	1.00
R6993:Dnah7b	UTSW	1	46,195,139 (GRCm38)	critical splice donor site	probably null
R7040:Dnah7b	UTSW	1	46,236,809 (GRCm38)	missense	probably benign	0.01
R7117:Dnah7b	UTSW	1	46,352,813 (GRCm38)	critical splice acceptor site	probably null
R7135:Dnah7b	UTSW	1	46,139,710 (GRCm38)	missense	probably damaging	0.99
R7153:Dnah7b	UTSW	1	46,126,804 (GRCm38)	missense	probably benign	0.05
R7189:Dnah7b	UTSW	1	46,242,142 (GRCm38)	missense	probably damaging	1.00
R7237:Dnah7b	UTSW	1	46,139,966 (GRCm38)	missense	probably damaging	0.98
R7243:Dnah7b	UTSW	1	46,083,754 (GRCm38)	missense	probably benign
R7244:Dnah7b	UTSW	1	46,277,143 (GRCm38)	missense	probably damaging	0.99
R7248:Dnah7b	UTSW	1	46,142,085 (GRCm38)	missense	possibly damaging	0.83
R7318:Dnah7b	UTSW	1	46,195,372 (GRCm38)	missense	probably damaging	1.00
R7375:Dnah7b	UTSW	1	46,303,634 (GRCm38)	missense	probably damaging	1.00
R7483:Dnah7b	UTSW	1	46,175,419 (GRCm38)	missense	probably damaging	1.00
R7486:Dnah7b	UTSW	1	46,290,734 (GRCm38)	missense	probably damaging	1.00
R7498:Dnah7b	UTSW	1	46,325,765 (GRCm38)	missense	probably damaging	1.00
R7501:Dnah7b	UTSW	1	46,356,554 (GRCm38)	missense	probably damaging	1.00
R7513:Dnah7b	UTSW	1	46,124,346 (GRCm38)	missense	probably benign	0.06
R7547:Dnah7b	UTSW	1	46,214,413 (GRCm38)	missense	possibly damaging	0.82
R7620:Dnah7b	UTSW	1	46,268,634 (GRCm38)	missense	probably damaging	1.00
R7670:Dnah7b	UTSW	1	46,109,302 (GRCm38)	missense	probably benign
R7676:Dnah7b	UTSW	1	46,234,164 (GRCm38)	nonsense	probably null
R7731:Dnah7b	UTSW	1	46,139,745 (GRCm38)	missense	probably benign	0.00
R7760:Dnah7b	UTSW	1	46,201,253 (GRCm38)	missense	probably damaging	1.00
R7768:Dnah7b	UTSW	1	46,137,474 (GRCm38)	missense	probably benign
R7807:Dnah7b	UTSW	1	46,214,367 (GRCm38)	missense	probably benign
R7895:Dnah7b	UTSW	1	46,249,950 (GRCm38)	missense	probably damaging	1.00
R7911:Dnah7b	UTSW	1	46,139,678 (GRCm38)	missense	probably damaging	1.00
R7924:Dnah7b	UTSW	1	46,219,430 (GRCm38)	missense	probably benign	0.04
R7944:Dnah7b	UTSW	1	46,227,003 (GRCm38)	missense	probably benign
R7946:Dnah7b	UTSW	1	46,233,579 (GRCm38)	missense	probably damaging	1.00
R7983:Dnah7b	UTSW	1	46,243,424 (GRCm38)	missense	probably damaging	1.00
R8012:Dnah7b	UTSW	1	46,243,365 (GRCm38)	missense	probably damaging	1.00
R8069:Dnah7b	UTSW	1	46,224,706 (GRCm38)	nonsense	probably null
R8094:Dnah7b	UTSW	1	46,126,804 (GRCm38)	missense	probably benign	0.01
R8137:Dnah7b	UTSW	1	46,233,753 (GRCm38)	missense	probably damaging	1.00
R8167:Dnah7b	UTSW	1	46,253,511 (GRCm38)	missense	possibly damaging	0.95
R8268:Dnah7b	UTSW	1	46,356,576 (GRCm38)	missense	probably benign	0.43
R8309:Dnah7b	UTSW	1	46,139,872 (GRCm38)	missense	probably damaging	1.00
R8313:Dnah7b	UTSW	1	46,175,296 (GRCm38)	missense	possibly damaging	0.81
R8410:Dnah7b	UTSW	1	46,356,659 (GRCm38)	critical splice donor site	probably null
R8438:Dnah7b	UTSW	1	46,188,679 (GRCm38)	missense	probably damaging	1.00
R8446:Dnah7b	UTSW	1	46,290,715 (GRCm38)	missense	probably damaging	1.00
R8471:Dnah7b	UTSW	1	46,099,490 (GRCm38)	missense	possibly damaging	0.92
R8551:Dnah7b	UTSW	1	46,116,200 (GRCm38)	missense	possibly damaging	0.94
R8711:Dnah7b	UTSW	1	46,175,438 (GRCm38)	missense	probably damaging	1.00
R8745:Dnah7b	UTSW	1	46,182,464 (GRCm38)	missense	possibly damaging	0.82
R8765:Dnah7b	UTSW	1	46,352,999 (GRCm38)	missense	possibly damaging	0.91
R8797:Dnah7b	UTSW	1	46,123,646 (GRCm38)	missense	probably damaging	1.00
R8805:Dnah7b	UTSW	1	46,234,145 (GRCm38)	missense	possibly damaging	0.90
R8830:Dnah7b	UTSW	1	46,191,793 (GRCm38)	missense	probably damaging	1.00
R8861:Dnah7b	UTSW	1	46,241,076 (GRCm38)	missense	possibly damaging	0.82
R8905:Dnah7b	UTSW	1	46,253,374 (GRCm38)	missense	probably damaging	0.99
R9009:Dnah7b	UTSW	1	46,223,072 (GRCm38)	missense	probably benign	0.00
R9058:Dnah7b	UTSW	1	46,243,415 (GRCm38)	missense	probably damaging	1.00
R9130:Dnah7b	UTSW	1	46,134,514 (GRCm38)	missense	probably benign	0.01
R9131:Dnah7b	UTSW	1	46,227,020 (GRCm38)	missense	probably damaging	1.00
R9181:Dnah7b	UTSW	1	46,142,034 (GRCm38)	missense	probably damaging	1.00
R9182:Dnah7b	UTSW	1	46,290,878 (GRCm38)	missense	probably benign	0.06
R9223:Dnah7b	UTSW	1	46,322,260 (GRCm38)	missense	probably benign	0.12
R9391:Dnah7b	UTSW	1	46,233,754 (GRCm38)	nonsense	probably null
R9392:Dnah7b	UTSW	1	46,123,738 (GRCm38)	nonsense	probably null
R9456:Dnah7b	UTSW	1	46,126,793 (GRCm38)	missense	possibly damaging	0.82
R9498:Dnah7b	UTSW	1	46,214,404 (GRCm38)	missense	probably benign	0.27
R9553:Dnah7b	UTSW	1	46,225,796 (GRCm38)	missense	probably damaging	0.99
R9598:Dnah7b	UTSW	1	46,253,461 (GRCm38)	missense	possibly damaging	0.67
R9653:Dnah7b	UTSW	1	46,213,384 (GRCm38)	missense	possibly damaging	0.55
R9781:Dnah7b	UTSW	1	46,337,594 (GRCm38)	splice site	probably null
RF020:Dnah7b	UTSW	1	46,373,261 (GRCm38)	missense	possibly damaging	0.84
V8831:Dnah7b	UTSW	1	46,373,298 (GRCm38)	nonsense	probably null
X0023:Dnah7b	UTSW	1	46,303,577 (GRCm38)	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- AGGTCTGCACTGTGCTTATTC -3'
(R):5'- GGCGAAGAACACCCTTATCC -3'

Sequencing Primer
(F):5'- AAGATCTTGTGATTTCCCATTGTTTG -3'
(R):5'- TTATCCCCAGAGATGAAAACAGG -3'

Posted On

2015-01-11